version
PlantPromoterDB promoter information of AT5G51440

Summary of Gene (AT5G51440)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G51440  TAIR      NCBI 
Gene model AT5G51440  
Description 23.5 kDa mitochondrial small heat shock protein (HSP23.5-M); FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to heat; EXPRESSED IN: 7 plant structures; EXPRESSED DURING: M germinated pollen stage, 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Heat shock protein Hsp20 (InterPro:IPR002068), HSP20-like chaperone (InterPro:IPR008978); BEST Arabidopsis thaliana protein match is: ATHSP23.6-MITO (MITOCHONDRION-LOCALIZED SMALL HEAT SHOCK PROTEIN 23.6) (TAIR:AT4G25200.1); Has 2564 Blast hits to 2564 proteins in 629 species: Archae - 92; Bacteria - 1263; Metazoa - 2; Fungi - 89; Plants - 842; Viruses - 0; Other Eukaryotes - 276 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 5: 20890642-20891841)

Genome position     
from initiation codon
AT5G51440.1         
TSS from cDNA
TSS information
AT5G51440                        5'->3' (+)
Promoter sequence

 
AT5G51430.1         
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence






 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G51440

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakCclone+20891163-79
TSS clone peakAclone+20891165-77

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGNoneNoneNone

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakA5-20890873AT5G51430.1

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneAclone-20890911AT5G51430.1
TSS cloneGclone-20890889AT5G51430.1
TSS cloneTclone-20890856AT5G51430.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTTCTTCTCTTC-2089085520890867AT5G51430.1
Y PatchTTTCTTCTTC-2089089120890900AT5G51430.1
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGAGTCGGTTTAG-2089091620890926AT5G51430.1
 AtREG641AGTCGGTT    PPDB MotifAACCG(G/A), CCGAC  PLACE MotifCCGAC, RCCGAC 
 AtREG514  TCGGTTTA  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG511   CGGTTTAG PPDB MotifAACCG(G/A)  PLACE Motif 
REGGGGCCCAGA-2089098020890988AT5G51430.1
 AtREG363GGGCCCAG  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG397 GGCCCAGA PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
REGACGGCCCATCA-2089099420891004AT5G51430.1
 AtREG368ACGGCCCA    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG380 CGGCCCAT   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG403  GGCCCATC  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG635   GCCCATCA PPDB MotifGCCCA  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.