version
PlantPromoterDB promoter information of AT5G52180.1

Summary of Gene (AT5G52180.1)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G52180  TAIR      NCBI 
Gene model AT5G52180.1  
Description unknown protein; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 50 Blast hits to 50 proteins in 21 species: Archae - 0; Bacteria - 0; Metazoa - 37; Fungi - 0; Plants - 11; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 5: 21200991-21199792)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT5G52180.1                      5'->3' (-)
Promoter sequence

 
AT5G52170.1         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G52180.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA4-21202450-909
TSS peakA15-21201590-49

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneCclone-21201575-34

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxATATAAGA-2120248121202488-940-947
Y PatchTCTTCTTCT-2120157721201585-36-44
Y PatchCTCTCTTC-2120159121201598-50-57
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTTAAAGCCCATTGGGCCTTTT-2120163721201657-96-116
 AtREG545TTAAAGCC              PPDB Motif  PLACE Motif 
 AtREG365 TAAAGCCC             PPDB MotifGCCCA  PLACE Motif 
 AtREG376  AAAGCCCA            PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378   AAGCCCAT           PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG372    AGCCCATT          PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG551     GCCCATTG         PPDB MotifGCCCA  PLACE Motif 
 AtREG461        CATTGGGC      PPDB MotifGCCCA  PLACE Motif 
 AtREG352         ATTGGGCC     PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG356          TTGGGCCT    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG353           TGGGCCTT   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG359            GGGCCTTT  PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG459             GGCCTTTT PPDB Motif  PLACE Motif 
REGAAACCGAACCGAACCGGAA-2120254621202564-1005-1023
 AtREG568AAACCGAA            PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG556 AACCGAACCGAAC      PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG451  ACCGAACCGAACC     PPDB Motif  PLACE Motif 
 AtREG456   CCGAACCGAACCG    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG575    CGAACCGA        PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG423         CGAACCGG   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG579          GAACCGGA  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG534           AACCGGAA PPDB MotifAACCG(G/A)  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.