version
PlantPromoterDB promoter information of AT5G52180.1

Summary of Gene (AT5G52180.1)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G52180  TAIR      NCBI 
Gene model AT5G52180.1  
Description unknown protein; LOCATED IN: endomembrane system; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 50 Blast hits to 50 proteins in 21 species: Archae - 0; Bacteria - 0; Metazoa - 37; Fungi - 0; Plants - 11; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 5: 21205241-21204042)

Genome position     
from initiation codon
AT5G52200.1         
TSS from cDNA
TSS information
AT5G52180.1                      5'->3' (-)
Promoter sequence





 
AT5G52210.1         
AT5G52210.2         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G52180.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA4-21202450-909
TSS peakA15-21201590-49

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneCclone-21201575-34

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxATATAAGA-2120248121202488-940-947
Y PatchTCTTCTTCT-2120157721201585-36-44
Y PatchCTCTCTTC-2120159121201598-50-57
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTTAAAGCCCATTGGGCCTTTT-2120163721201657-96-116
 AtREG545TTAAAGCC              PPDB Motif  PLACE Motif 
 AtREG365 TAAAGCCC             PPDB MotifGCCCA  PLACE Motif 
 AtREG376  AAAGCCCA            PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378   AAGCCCAT           PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG372    AGCCCATT          PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG551     GCCCATTG         PPDB MotifGCCCA  PLACE Motif 
 AtREG461        CATTGGGC      PPDB MotifGCCCA  PLACE Motif 
 AtREG352         ATTGGGCC     PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG356          TTGGGCCT    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG353           TGGGCCTT   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG359            GGGCCTTT  PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG459             GGCCTTTT PPDB Motif  PLACE Motif 
REGAAACCGAACCGAACCGGAA-2120254621202564-1005-1023
 AtREG568AAACCGAA            PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG556 AACCGAACCGAAC      PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG451  ACCGAACCGAACC     PPDB Motif  PLACE Motif 
 AtREG456   CCGAACCGAACCG    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG575    CGAACCGA        PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG423         CGAACCGG   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG579          GAACCGGA  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG534           AACCGGAA PPDB MotifAACCG(G/A)  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakG8-21204759AT5G52200.1

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneGclone-21204759AT5G52200.1
TSS cloneAclone-21204747AT5G52200.1
TSS cloneCclone-21204734AT5G52200.1
TSS cloneGclone+21205001AT5G52210.1, AT5G52210.2
TSS clone peakTclone+21205006AT5G52210.1, AT5G52210.2
TSS cloneAclone+21205009AT5G52210.1, AT5G52210.2

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGAAAGTCAA-2120484021204847AT5G52200.1
 AtREG632AAAGTCAA PPDB Motif  PLACE MotifTTGAC 
REGATCCACGTGGCGG-2120486921204881AT5G52200.1
 AtREG547ATCCACGT     ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG 
 AtREG408 TCCACGTG    ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG 
 AtREG367   CACGTGGC  ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, CACGTG, ACGTGKC, CACGTGGC 
 AtREG371    ACGTGGCG ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, ACGTGKC 
 AtREG560     CGTGGCGGABA PPDB MotifCCGAC  PLACE MotifGCCAC 
REGTTCACGCGCTT-2120490621204916AT5G52200.1
 AtREG631TTCACGCG   Drought PPDB Motif  PLACE Motif 
 AtREG395 TCACGCGC   PPDB MotifACGCGC  PLACE Motif 
 AtREG381  CACGCGCT  PPDB MotifACGCGC  PLACE Motif 
 AtREG492   ACGCGCTT PPDB MotifACGCGC  PLACE Motif 
REGTACCCTTA-2120492521204932AT5G52200.1
 AtREG570TACCCTTA PPDB MotifACCCT  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.