version
PlantPromoterDB promoter information of AT5G53560.1

Summary of Gene (AT5G53560.1)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G53560  TAIR      NCBI 
Gene model AT5G53560.1  
Description Encodes a cytochrome b5 isoform that can be reduced by AtCBR, a cytochrome b5 reductase.  
#
#

Overview

Focused view (chromosome 5: 21758628-21759827)

Genome position     
from initiation codon
AT5G53550.1         
TSS from cDNA
TSS information
AT5G53560.1                      5'->3' (+)
Promoter sequence






 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G53560.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG34+21759411-217

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneTclone+21759412-216
TSS cloneTclone+21759414-214
TSS cloneTclone+21759415-213
TSS cloneTclone+21759417-211
TSS cloneCclone+21759419-209
TSS cloneAclone+21759422-206
TSS cloneGclone+21759435-193
TSS cloneGclone+21759436-192

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCGTCTTCT+2175941021759417-218-211
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGACACGTCAT+2175917221759180-456-448
 AtREG517ACACGTCA ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG 
 AtREG483 CACGTCAT PPDB MotifACGT  PLACE MotifACGT, ACGTG 
REGACGTGGAC+2175920421759211-424-417
 AtREG513ACGTGGACABA, DREB1Aox PPDB MotifACGT  PLACE MotifACGT, ACGTG 
REGCAAAGCCCAATT+2175926221759273-366-355
 AtREG559CAAAGCCC     PPDB MotifGCCCA  PLACE Motif 
 AtREG376 AAAGCCCA    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407  AAGCCCAA   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG402   AGCCCAAT  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG418    GCCCAATT PPDB MotifGCCCA  PLACE Motif 
REGAAAGTCAAAGCCCAACT+2175928421759300-344-328
 AtREG632AAAGTCAA          PPDB Motif  PLACE MotifTTGAC 
 AtREG559     CAAAGCCC     PPDB MotifGCCCA  PLACE Motif 
 AtREG376      AAAGCCCA    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407       AAGCCCAA   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG574        AGCCCAAC  PPDB MotifGCCCA, CCAACGG  PLACE MotifTGGGCY 
 AtREG607         GCCCAACT PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.