version
PlantPromoterDB promoter information of AT5G53620.2

Summary of Gene (AT5G53620.2)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G53620  TAIR      NCBI 
Gene model AT5G53620.2  
Description unknown protein; INVOLVED IN: biological_process unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; Has 24768 Blast hits to 16126 proteins in 919 species: Archae - 127; Bacteria - 1854; Metazoa - 13180; Fungi - 1596; Plants - 564; Viruses - 82; Other Eukaryotes - 7365 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 5: 21781067-21782266)

Genome position     
from initiation codon
AT5G53620.1         
AT5G53620.3         
TSS from cDNA
TSS information
AT5G53620.2                      5'->3' (+)
Promoter sequence

 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G53620.2

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA13+21780947-270

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneGclone+21780952-265

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTCAGCCCAATAGGCCCGT+2178068421780701-533-516
 AtREG609TCAGCCCA           PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG402  AGCCCAAT         PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG355   GCCCAATA        PPDB MotifGCCCA  PLACE Motif 
 AtREG624    CCCAATAG       PPDB MotifGCCCA  PLACE Motif 
 AtREG424       AATAGGCC    PPDB Motif  PLACE Motif 
 AtREG362        ATAGGCCC   PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG429          AGGCCCGT PPDB MotifACGGGC  PLACE MotifGGGCC 
REGTTCGGTTTGG+2178070921780718-508-499
 AtREG568TTCGGTTT   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG550  CGGTTTGG PPDB MotifAACCG(G/A)  PLACE Motif 
REGAAACCGAA+2178080321780810-414-407
 AtREG568AAACCGAA PPDB MotifAACCG(G/A)  PLACE Motif 
REGCCAAACCGAA+2178081821780827-399-390
 AtREG550CCAAACCG   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG568  AAACCGAA PPDB MotifAACCG(G/A)  PLACE Motif 
REGCCAAACCGAA+2178083521780844-382-373
 AtREG550CCAAACCG   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG568  AAACCGAA PPDB MotifAACCG(G/A)  PLACE Motif 
REGCCAAACCGGATTAAATGGGTCAAA+2178085221780875-365-342
 AtREG550CCAAACCG                 PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG496 CAAACCGG                PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG521  AAACCGGA               PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG561   AACCGGAT              PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG443           TAAATGGG      PPDB MotifGCCCA  PLACE Motif 
 AtREG592                GGGTCAAA PPDB Motif  PLACE MotifTTGAC, TTGACC 
REGTCAGCCCAATAGGCCCAACA+2178088221780901-335-316
 AtREG609TCAGCCCA             PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG402  AGCCCAAT           PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG355   GCCCAATA          PPDB MotifGCCCA  PLACE Motif 
 AtREG624    CCCAATAG         PPDB MotifGCCCA  PLACE Motif 
 AtREG424       AATAGGCC      PPDB Motif  PLACE Motif 
 AtREG362        ATAGGCCC     PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG358         TAGGCCCA    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG356          AGGCCCAA   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG449           GGCCCAAC  PPDB MotifGCCCA, CCAACGG  PLACE MotifGGGCC, TGGGCY 
 AtREG543            GCCCAACA PPDB MotifGCCCA  PLACE MotifCAACA 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.