version
PlantPromoterDB promoter information of AT5G53640.1

Summary of Gene (AT5G53640.1)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G53640  TAIR      NCBI 
Gene model AT5G53640.1  
Description F-box family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: flower; EXPRESSED DURING: 4 anthesis; CONTAINS InterPro DOMAIN/s: FBD (InterPro:IPR013596), Cyclin-like F-box (InterPro:IPR001810), FBD-like (InterPro:IPR006566), Leucine-rich repeat 2 (InterPro:IPR013101); BEST Arabidopsis thaliana protein match is: F-box family protein (TAIR:AT5G25850.1); Has 1992 Blast hits to 1237 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 1991; Viruses - 0; Other Eukaryotes - 1 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 5: 21791690-21790491)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT5G53640.1                      5'->3' (-)
Promoter sequence

 
AT5G53650.1         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence








 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G53640.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGNoneNoneNone

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakG2+21791225AT5G53650.1

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneGclone+21791177AT5G53650.1
TSS cloneAclone+21791243AT5G53650.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTTTCTCTCTCTCT+2179118321791197AT5G53650.1
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGGACGCCGTTT+2179104721791056AT5G53650.1
 AtREG540GACGCCGT   PPDB Motif  PLACE Motif 
 AtREG497 ACGCCGTT  PPDB MotifAAACG(C/G), CCAACGG  PLACE Motif 
 AtREG524  CGCCGTTT PPDB MotifAAACG(C/G)  PLACE Motif 
REGCCACGTCGTTTTGA+2179111021791123AT5G53650.1
 AtREG465CCACGTCG       PPDB MotifACGT  PLACE MotifACGT, ACGTG 
 AtREG493  ACGTCGTT     PPDB MotifACGT  PLACE MotifACGT 
 AtREG415   CGTCGTTT    PPDB Motif  PLACE Motif 
 AtREG520    GTCGTTTT   PPDB Motif  PLACE Motif 
 AtREG653      CGTTTTGA PPDB MotifAAACG(C/G)  PLACE Motif 
REGGTCGTTTTGA+2179116221791171AT5G53650.1
 AtREG520GTCGTTTT   PPDB Motif  PLACE Motif 
 AtREG653  CGTTTTGA PPDB MotifAAACG(C/G)  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.