version
PlantPromoterDB promoter information of AT5G55140.1

Summary of Gene (AT5G55140.1)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G55140  TAIR      NCBI 
Gene model AT5G55140.1  
Description ribosomal protein L30 family protein; FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: ribosome, intracellular, large ribosomal subunit; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L30p/L7e, N-terminal (InterPro:IPR000517), Ribosomal protein L30, bacterial-type (InterPro:IPR005996), Ribosomal protein L30, ferredoxin-like fold domain (InterPro:IPR016082); Has 388 Blast hits to 388 proteins in 155 species: Archae - 0; Bacteria - 328; Metazoa - 2; Fungi - 0; Plants - 26; Viruses - 0; Other Eukaryotes - 32 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 5: 22380370-22381569)

Genome position     
from initiation codon
AT5G55135.1         
TSS from cDNA
TSS information
AT5G55140.1                      5'->3' (+)
Promoter sequence













 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G55140.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG8+22381037-333

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTCTTTC+2238107422381081-296-289
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTAATTGGGCCCAGATAAAGCCCAAAT+2238092422380949-446-421
 AtREG600TAATTGGG                   PPDB MotifGCCCA  PLACE Motif 
 AtREG418 AATTGGGC                  PPDB MotifGCCCA  PLACE Motif 
 AtREG352  ATTGGGCC                 PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG392   TTGGGCCC                PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG422    TGGGCCCA               PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG363     GGGCCCAG              PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG397      GGCCCAGA             PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG601             ATAAAGCC      PPDB Motif  PLACE Motif 
 AtREG365              TAAAGCCC     PPDB MotifGCCCA  PLACE Motif 
 AtREG376               AAAGCCCA    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407                AAGCCCAA   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG469                 AGCCCAAA  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG421                  GCCCAAAT PPDB MotifGCCCA  PLACE Motif 
REGCAAAACGCTGTCGTTTA+2238096522380981-405-389
 AtREG585CAAAACGC          PPDB MotifAAACG(C/G)  PLACE MotifCAAAACGC 
 AtREG626  AAACGCTG        PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG569        TGTCGTTT  PPDB Motif  PLACE Motif 
 AtREG565         GTCGTTTA PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.