version
PlantPromoterDB promoter information of AT5G55210.1

Summary of Gene (AT5G55210.1)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G55210  TAIR      NCBI 
Gene model AT5G55210.1  
Description unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT4G22320.1); Has 24 Blast hits to 24 proteins in 8 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 24; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 5: 22398374-22397175)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT5G55210.1                      5'->3' (-)
Promoter sequence





 
AT5G55220.1         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence





 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G55210.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA8-22397382-8

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneTclone-22397446-72
TSS cloneGclone-22397387-13
TSS cloneAclone-22397386-12

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTCAAAACGCAGCGTTT-2239743122397446-57-72
 AtREG653TCAAAACG         PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG585 CAAAACGC        PPDB MotifAAACG(C/G)  PLACE MotifCAAAACGC 
 AtREG369      CGCAGCGT   PPDB Motif  PLACE Motif 
 AtREG626        CAGCGTTT PPDB MotifAAACG(C/G)  PLACE Motif 
REGTAAAACGCCGCGTTTTGA-2239748922397506-115-132
 AtREG564TAAAACGC           PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG650 AAAACGCC          PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG566        CGCGTTTT   PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG585         GCGTTTTG  PPDB MotifAAACG(C/G)  PLACE MotifCAAAACGC 
 AtREG653          CGTTTTGA PPDB MotifAAACG(C/G)  PLACE Motif 
REGTAAAACGC-2239753722397544-163-170
 AtREG564TAAAACGC PPDB MotifAAACG(C/G)  PLACE Motif 
REGTAAAACGCTGCG-2239757122397582-197-208
 AtREG564TAAAACGC     PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG626  AAACGCTG   PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG369    ACGCTGCG PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakA2+22397641AT5G55220.1

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneAclone+22397616AT5G55220.1
TSS cloneTclone+22397635AT5G55220.1
TSS cloneTclone+22397639AT5G55220.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGAAACGCTGCGTTTTGA+2239743122397446AT5G55220.1
 AtREG626AAACGCTG         PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG369  ACGCTGCG       PPDB Motif  PLACE Motif 
 AtREG585       GCGTTTTG  PPDB MotifAAACG(C/G)  PLACE MotifCAAAACGC 
 AtREG653        CGTTTTGA PPDB MotifAAACG(C/G)  PLACE Motif 
REGTCAAAACGCGGCGTTTTA+2239748922397506AT5G55220.1
 AtREG653TCAAAACG           PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG585 CAAAACGC          PPDB MotifAAACG(C/G)  PLACE MotifCAAAACGC 
 AtREG566  AAAACGCG         PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG650         GGCGTTTT  PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG564          GCGTTTTA PPDB MotifAAACG(C/G)  PLACE Motif 
REGGCGTTTTA+2239753722397544AT5G55220.1
 AtREG564GCGTTTTA PPDB MotifAAACG(C/G)  PLACE Motif 
REGCGCAGCGTTTTA+2239757122397582AT5G55220.1
 AtREG369CGCAGCGT     PPDB Motif  PLACE Motif 
 AtREG626  CAGCGTTT   PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG564    GCGTTTTA PPDB MotifAAACG(C/G)  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.