version
PlantPromoterDB promoter information of AT5G55220.1

Summary of Gene (AT5G55220.1)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G55220  TAIR      NCBI 
Gene model AT5G55220.1  
Description trigger factor type chaperone family protein; FUNCTIONS IN: peptidyl-prolyl cis-trans isomerase activity; INVOLVED IN: protein folding, protein transport; LOCATED IN: chloroplast, chloroplast stroma, chloroplast envelope; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: Trigger factor, C-terminal, bacterial (InterPro:IPR008880), Trigger factor, ribosome-binding, bacterial (InterPro:IPR008881), Peptidyl-prolyl cis-trans isomerase, FKBP-type (InterPro:IPR001179); Has 4453 Blast hits to 4437 proteins in 1318 species: Archae - 0; Bacteria - 2754; Metazoa - 39; Fungi - 3; Plants - 24; Viruses - 2; Other Eukaryotes - 1631 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 5: 22396677-22397876)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT5G55220.1                      5'->3' (+)
Promoter sequence





 
AT5G55210.1         
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence





 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G55220.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA2+22397641-36

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone+22397616-61
TSS cloneTclone+22397635-42
TSS cloneTclone+22397639-38

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAAACGCTGCGTTTTGA+2239743122397446-246-231
 AtREG626AAACGCTG         PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG369  ACGCTGCG       PPDB Motif  PLACE Motif 
 AtREG585       GCGTTTTG  PPDB MotifAAACG(C/G)  PLACE MotifCAAAACGC 
 AtREG653        CGTTTTGA PPDB MotifAAACG(C/G)  PLACE Motif 
REGTCAAAACGCGGCGTTTTA+2239748922397506-188-171
 AtREG653TCAAAACG           PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG585 CAAAACGC          PPDB MotifAAACG(C/G)  PLACE MotifCAAAACGC 
 AtREG566  AAAACGCG         PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG650         GGCGTTTT  PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG564          GCGTTTTA PPDB MotifAAACG(C/G)  PLACE Motif 
REGGCGTTTTA+2239753722397544-140-133
 AtREG564GCGTTTTA PPDB MotifAAACG(C/G)  PLACE Motif 
REGCGCAGCGTTTTA+2239757122397582-106-95
 AtREG369CGCAGCGT     PPDB Motif  PLACE Motif 
 AtREG626  CAGCGTTT   PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG564    GCGTTTTA PPDB MotifAAACG(C/G)  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakA8-22397382AT5G55210.1

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneTclone-22397446AT5G55210.1
TSS cloneGclone-22397387AT5G55210.1
TSS cloneAclone-22397386AT5G55210.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGTCAAAACGCAGCGTTT-2239743122397446AT5G55210.1
 AtREG653TCAAAACG         PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG585 CAAAACGC        PPDB MotifAAACG(C/G)  PLACE MotifCAAAACGC 
 AtREG369      CGCAGCGT   PPDB Motif  PLACE Motif 
 AtREG626        CAGCGTTT PPDB MotifAAACG(C/G)  PLACE Motif 
REGTAAAACGCCGCGTTTTGA-2239748922397506AT5G55210.1
 AtREG564TAAAACGC           PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG650 AAAACGCC          PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG566        CGCGTTTT   PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG585         GCGTTTTG  PPDB MotifAAACG(C/G)  PLACE MotifCAAAACGC 
 AtREG653          CGTTTTGA PPDB MotifAAACG(C/G)  PLACE Motif 
REGTAAAACGC-2239753722397544AT5G55210.1
 AtREG564TAAAACGC PPDB MotifAAACG(C/G)  PLACE Motif 
REGTAAAACGCTGCG-2239757122397582AT5G55210.1
 AtREG564TAAAACGC     PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG626  AAACGCTG   PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG369    ACGCTGCG PPDB Motif  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.