version
PlantPromoterDB promoter information of AT5G56670.1

Summary of Gene (AT5G56670.1)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G56670  TAIR      NCBI 
Gene model AT5G56670.1  
Description 40S ribosomal protein S30 (RPS30C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation; LOCATED IN: cytosolic small ribosomal subunit, ribosome; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein S30 (InterPro:IPR006846); BEST Arabidopsis thaliana protein match is: 40S ribosomal protein S30 (RPS30B) (TAIR:AT4G29390.1); Has 487 Blast hits to 487 proteins in 186 species: Archae - 2; Bacteria - 0; Metazoa - 223; Fungi - 90; Plants - 56; Viruses - 1; Other Eukaryotes - 115 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 5: 22936981-22935782)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT5G56670.1                      5'->3' (-)
Promoter sequence













 
AT5G56680.1         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence





 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G56670.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA30-22936064-83

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone-22936064-83
TSS cloneAclone-22936063-82
TSS cloneCclone-22936060-79
TSS cloneTclone-22936059-78
TSS cloneAclone-22936057-76
TSS cloneAclone-22936055-74

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTATGGGCCCATAAAGCCCAATAT-2293611022936132-129-151
 AtREG391 ATGGGCCCAT             PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG422  TGGGCCCA              PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG364TATGGGCCCATA            PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG394     GCCCATAA           PPDB MotifGCCCA  PLACE Motif 
 AtREG601         ATAAAGCC       PPDB Motif  PLACE Motif 
 AtREG365          TAAAGCCC      PPDB MotifGCCCA  PLACE Motif 
 AtREG376           AAAGCCCA     PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407            AAGCCCAA    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG402             AGCCCAAT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG355              GCCCAATA  PPDB MotifGCCCA  PLACE Motif 
 AtREG509               CCCAATAT PPDB Motif  PLACE Motif 
REGATAAAGCCCAATAG-2293614822936161-167-180
 AtREG601ATAAAGCC       PPDB Motif  PLACE Motif 
 AtREG365 TAAAGCCC      PPDB MotifGCCCA  PLACE Motif 
 AtREG376  AAAGCCCA     PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407   AAGCCCAA    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG402    AGCCCAAT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG355     GCCCAATA  PPDB MotifGCCCA  PLACE Motif 
 AtREG624      CCCAATAG PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakA5+22936554AT5G56680.1

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneGclone+22936588AT5G56680.1
TSS cloneGclone+22936617AT5G56680.1
TSS cloneCclone+22936620AT5G56680.1
TSS cloneTclone+22936626AT5G56680.1
TSS cloneGclone+22936634AT5G56680.1
TSS cloneAclone+22936638AT5G56680.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCATCTCTC+2293653522936542AT5G56680.1
Y PatchCTCTCTCT+2293656122936568AT5G56680.1
Y PatchCCTCTCCTCTT+2293657322936583AT5G56680.1
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGCCCATATA+2293650122936508AT5G56680.1
 AtREG620CCCATATA PPDB MotifGCCCA  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.