version
PlantPromoterDB promoter information of AT5G56710.1

Summary of Gene (AT5G56710.1)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G56710  TAIR      NCBI 
Gene model AT5G56710.1  
Description 60S ribosomal protein L31 (RPL31C); FUNCTIONS IN: structural constituent of ribosome; INVOLVED IN: translation, ribosome biogenesis; LOCATED IN: cytosolic ribosome, cytosolic large ribosomal subunit, ribosome, cell wall; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Ribosomal protein L31e (InterPro:IPR000054); BEST Arabidopsis thaliana protein match is: 60S ribosomal protein L31 (RPL31B) (TAIR:AT4G26230.1); Has 857 Blast hits to 857 proteins in 264 species: Archae - 102; Bacteria - 2; Metazoa - 389; Fungi - 88; Plants - 124; Viruses - 0; Other Eukaryotes - 152 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 5: 22945767-22944568)

Genome position     
from initiation codon
AT5G56710.2         
TSS from cDNA
TSS information
AT5G56710.1                      5'->3' (-)
Promoter sequence












 
AT5G56720.1         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G56710.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG17-22944962-195

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneTclone-22944967-200
TSS cloneTclone-22944963-196
TSS cloneGclone-22944962-195

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxCATATATATG-2294499122945000-224-233
Y PatchCTCTCTCTCTCTCTTTCT-2294491322944930-146-163
Y PatchTTCTCTTCCTTC-2294497422944985-207-218
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAATAGGCCCATTAAAGCCCAAT-2294503522945056-268-289
 AtREG424AATAGGCC               PPDB Motif  PLACE Motif 
 AtREG362 ATAGGCCC              PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG358  TAGGCCCA             PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG354   AGGCCCAT            PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG361    GGCCCATT           PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG357     GCCCATTA          PPDB MotifGCCCA  PLACE Motif 
 AtREG396      CCCATTAA         PPDB MotifGCCCA  PLACE MotifTTAATGG 
 AtREG545          TTAAAGCC     PPDB Motif  PLACE Motif 
 AtREG365           TAAAGCCC    PPDB MotifGCCCA  PLACE Motif 
 AtREG376            AAAGCCCA   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407             AAGCCCAA  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG402              AGCCCAAT PPDB MotifGCCCA  PLACE MotifTGGGCY 
REGATTTGGGCCGTAAATGGGCTA-2294510622945126-339-359
 AtREG421ATTTGGGC              PPDB MotifGCCCA  PLACE Motif 
 AtREG373 TTTGGGCC             PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG414  TTGGGCCG            PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG368   TGGGCCGT           PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG499    GGGCCGTA          PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG443          TAAATGGG    PPDB MotifGCCCA  PLACE Motif 
 AtREG386           AAATGGGC   PPDB MotifGCCCA  PLACE Motif 
 AtREG372            AATGGGCT  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG581             ATGGGCTA PPDB MotifGCCCA  PLACE MotifTGGGCY 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.