version
PlantPromoterDB promoter information of AT5G57815.1

Summary of Gene (AT5G57815.1)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G57815  TAIR      NCBI 
Gene model AT5G57815.1  
Description cytochrome c oxidase subunit 6b, putative; FUNCTIONS IN: cytochrome-c oxidase activity; LOCATED IN: mitochondrion; EXPRESSED IN: 24 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Cytochrome c oxidase, subunit VIb (InterPro:IPR003213); BEST Arabidopsis thaliana protein match is: cytochrome c oxidase subunit 6b, putative (TAIR:AT4G28060.1); Has 426 Blast hits to 426 proteins in 126 species: Archae - 0; Bacteria - 0; Metazoa - 243; Fungi - 77; Plants - 83; Viruses - 0; Other Eukaryotes - 23 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 5: 23425753-23426952)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT5G57815.1                      5'->3' (+)
Promoter sequence















 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G57815.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA4+23426677-76

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneTclone+23426678-75
TSS cloneGclone+23426697-56
TSS cloneGclone+23426700-53
TSS cloneCclone+23426708-45
TSS cloneTclone+23426709-44

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTTTCTTCTCT+2342670523426714-48-39
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTTTTGGGCCCATTAAAGCCCAATAAAATGGGCTA+2342659523426628-158-125
 AtREG529TTTTGGGC                           PPDB MotifGCCCA  PLACE Motif 
 AtREG373 TTTGGGCC                          PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG392  TTGGGCCC                         PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG422   TGGGCCCA                        PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG391    GGGCCCAT                       PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG361     GGCCCATT                      PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG357      GCCCATTA                     PPDB MotifGCCCA  PLACE Motif 
 AtREG396       CCCATTAA                    PPDB MotifGCCCA  PLACE MotifTTAATGG 
 AtREG545           TTAAAGCC                PPDB Motif  PLACE Motif 
 AtREG365            TAAAGCCC               PPDB MotifGCCCA  PLACE Motif 
 AtREG376             AAAGCCCA              PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407              AAGCCCAA             PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG402               AGCCCAAT            PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG355                GCCCAATA           PPDB MotifGCCCA  PLACE Motif 
 AtREG417                 CCCAATAA          PPDB MotifGCCCA  PLACE Motif 
 AtREG386                        AAATGGGC   PPDB MotifGCCCA  PLACE Motif 
 AtREG372                         AATGGGCT  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG581                          ATGGGCTA PPDB MotifGCCCA  PLACE MotifTGGGCY 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.