version
PlantPromoterDB promoter information of AT5G58030.1

Summary of Gene (AT5G58030.1)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G58030  TAIR      NCBI 
Gene model AT5G58030.1  
Description transport protein particle (TRAPP) component Bet3 family protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: ER to Golgi vesicle-mediated transport; LOCATED IN: cellular_component unknown; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Transport protein particle (TRAPP) component (InterPro:IPR007194), TRAPP I complex, Trs31 (InterPro:IPR016696); Has 400 Blast hits to 390 proteins in 159 species: Archae - 0; Bacteria - 0; Metazoa - 157; Fungi - 137; Plants - 31; Viruses - 0; Other Eukaryotes - 75 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 5: 23489483-23488284)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT5G58030.1                      5'->3' (-)
Promoter sequence

 
AT5G58040.1         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence







 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G58030.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA24-23488575-92

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneCclone-23488620-137
TSS cloneAclone-23488607-124
TSS cloneTclone-23488574-91
TSS cloneGclone-23488555-72

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCCAATTA-2348868123488688-198-205
 AtREG600CCCAATTA PPDB MotifGCCCA  PLACE Motif 
REGTTACCCCT-2348870123488708-218-225
 AtREG642TTACCCCT PPDB MotifACCCCT  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakG4+23488751AT5G58040.1

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneGclone+23488748AT5G58040.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxTGTATAAATA+2348871423488723AT5G58040.1
Y PatchCGTCTCTCTCTCTCT+2348878523488799AT5G58040.1
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGTTCGGTTTTCCGGT+2348848823488501AT5G58040.1
 AtREG568TTCGGTTT       PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG644      TTTCCGGT PPDB MotifAACCG(G/A)  PLACE Motif 
REGTTTCCGGT+2348855223488559AT5G58040.1
 AtREG644TTTCCGGT PPDB MotifAACCG(G/A)  PLACE Motif 
REGTAATTGGG+2348868123488688AT5G58040.1
 AtREG600TAATTGGG PPDB MotifGCCCA  PLACE Motif 
REGAGGGGTAA+2348870123488708AT5G58040.1
 AtREG642AGGGGTAA PPDB MotifACCCCT  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.