version
PlantPromoterDB promoter information of AT5G60160.1

Summary of Gene (AT5G60160.1)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G60160  TAIR      NCBI 
Gene model AT5G60160.1  
Description aspartyl aminopeptidase, putative; FUNCTIONS IN: aminopeptidase activity, zinc ion binding; INVOLVED IN: response to cadmium ion, proteolysis; LOCATED IN: plasma membrane, vacuole; EXPRESSED IN: 26 plant structures; EXPRESSED DURING: 15 growth stages; CONTAINS InterPro DOMAIN/s: Peptidase M18, aminopeptidase I (InterPro:IPR001948); BEST Arabidopsis thaliana protein match is: aspartyl aminopeptidase, putative (TAIR:AT5G04710.1); Has 1278 Blast hits to 1277 proteins in 389 species: Archae - 1; Bacteria - 687; Metazoa - 123; Fungi - 173; Plants - 41; Viruses - 0; Other Eukaryotes - 253 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 5: 24227783-24226584)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT5G60160.1                      5'->3' (-)
Promoter sequence











 
AT5G60170.1         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence












 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G60160.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA13-24226865-82

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneGclone-24226883-100
TSS cloneAclone-24226865-82
TSS cloneCclone-24226864-81
TSS cloneGclone-24226860-77
TSS cloneGclone-24226832-49

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCAATTGGGCTTTGTAATGGGCCAAT-2422691424226938-131-155
 AtREG647CAATTGGG                  PPDB Motif  PLACE Motif 
 AtREG418 AATTGGGC                 PPDB MotifGCCCA  PLACE Motif 
 AtREG402  ATTGGGCT                PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407   TTGGGCTT               PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG376    TGGGCTTT              PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG559     GGGCTTTG             PPDB MotifGCCCA  PLACE Motif 
 AtREG357             TAATGGGC     PPDB MotifGCCCA  PLACE Motif 
 AtREG361              AATGGGCC    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG490               ATGGGCCA   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG484                TGGGCCAA  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG446                 GGGCCAATCK PPDB MotifGCCCA  PLACE MotifGGGCC 
REGAAGGGTATTT-2422714124227150-358-367
 AtREG623AAGGGTAT   PPDB MotifACCCT  PLACE Motif 
 AtREG567 AGGGTATT  PPDB MotifACCCT  PLACE Motif 
 AtREG602  GGGTATTT PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakG2+24227464AT5G60170.1

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneTclone+24227417AT5G60170.1
TSS cloneAclone+24227437AT5G60170.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTCTTTCTCTCTCTCTCT+2422744524227463AT5G60170.1
Y PatchCTCTCTCTC+2422746824227476AT5G60170.1
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGAAACCGAACCGGAC+2422726524227278AT5G60170.1
 AtREG568AAACCGAA       PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG556 AACCGAAC      PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG451  ACCGAACC     PPDB Motif  PLACE Motif 
 AtREG456   CCGAACCG    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG423    CGAACCGG   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG579     GAACCGGA  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG573      AACCGGAC PPDB MotifAACCG(G/A)  PLACE Motif 
REGACGTGGAT+2422735624227363AT5G60170.1
 AtREG547ACGTGGATABA PPDB MotifACGT  PLACE MotifACGT, ACGTG 
REGAAAAGGCC+2422740824227415AT5G60170.1
 AtREG459AAAAGGCC PPDB Motif  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.