version
PlantPromoterDB promoter information of AT5G60390

Summary of Gene (AT5G60390)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G60390  TAIR      NCBI 
Gene model AT5G60390  
Description elongation factor 1-alpha / EF-1-alpha; FUNCTIONS IN: calmodulin binding, translation elongation factor activity; INVOLVED IN: translational elongation; LOCATED IN: mitochondrion, nucleus, plasma membrane, vacuole, cytoplasm; EXPRESSED IN: 6 plant structures; EXPRESSED DURING: L mature pollen stage, M germinated pollen stage; CONTAINS InterPro DOMAIN/s: Translation elongation factor EFTu/EF1A, C-terminal (InterPro:IPR004160), Translation elongation factor EFTu/EF1A, domain 2 (InterPro:IPR004161), Translation elongation factor EF1A/initiation factor IF2gamma, C-terminal (InterPro:IPR009001), Protein synthesis factor, GTP-binding (InterPro:IPR000795), Translation elongation and initiation factors/Ribosomal, beta-barrel (InterPro:IPR009000), Translation elongation factor EF1A, eukaryotic and archaeal (InterPro:IPR004539); BEST Arabidopsis thaliana protein match is: elongation factor 1-alpha / EF-1-alpha (TAIR:AT1G07940.2); Has 56847 Blast hits to 56774 proteins in 13741 species: Archae - 656; Bacteria - 18823; Metazoa - 15489; Fungi - 8699; Plants - 1228; Viruses - 3; Other Eukaryotes - 11949 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 5: 24288226-24289425)

Genome position     
from initiation codon
AT5G60390.1         
AT5G60390.2         
AT5G60390.3         
TSS from cDNA
TSS information
AT5G60390                        5'->3' (+)
Promoter sequence








 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G60390

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG792+24288664-562

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone+24288632-594
TSS cloneGclone+24288661-565
TSS cloneGclone+24288662-564
TSS cloneTclone+24288663-563
TSS cloneGclone+24288664-562
TSS cloneCclone+24288665-561
TSS cloneGclone+24288666-560
TSS cloneCclone+24288667-559
TSS cloneCclone+24288669-557
TSS cloneTclone+24288670-556
TSS cloneTclone+24288673-553
TSS cloneTclone+24288675-551
TSS cloneTclone+24288705-521

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxCTATAAGT+2428863024288637-596-589
Y PatchCTCCTTTC+2428870124288708-525-518
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAAAGGCCCAAAACGCGT+2428855224288568-674-658
 AtREG359AAAGGCCC          PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG353 AAGGCCCA         PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG356  AGGCCCAA        PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG373   GGCCCAAA       PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG529    GCCCAAAA      PPDB MotifGCCCA  PLACE Motif 
 AtREG585       CAAAACGC   PPDB MotifAAACG(C/G)  PLACE MotifCAAAACGC 
 AtREG566        AAAACGCG  PPDB MotifAAACG(C/G)  PLACE Motif 
 AtREG633         AAACGCGT PPDB MotifAAACG(C/G)  PLACE Motif 
REGACCCTAGA+2428861224288619-614-607
 AtREG658ACCCTAGA PPDB MotifACCCT  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.