version
PlantPromoterDB promoter information of AT5G60410.4

Summary of Gene (AT5G60410.4)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G60410  TAIR      NCBI 
Gene model AT5G60410.4  
Description Encodes a plant small ubiquitin-like modifier (SUMO) E3 ligase that is a focal controller of Pi starvation-dependent responses. Also required for SA and PAD4-mediated R gene signalling, which in turn confers innate immunity in Arabidopsis. Also involved in the regulation of plant growth, drought responses and freezing tolerance. This latter effect is most likely due to SIZ1 dependent ABI5 sumoylation.  
#
#

Overview

Focused view (chromosome 5: 24294226-24295425)

Genome position     
from initiation codon
AT5G60410.1         
AT5G60410.2         
AT5G60410.3         
AT5G60410.5         
TSS from cDNA
TSS information
AT5G60410.4                      5'->3' (+)
Promoter sequence




 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G60410.4

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG5+24294890-336

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneGclone+24294890-336
TSS cloneTclone+24294891-335

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTCTTCCT+2429491824294925-308-301
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCAAACCGGTC+2429462024294629-606-597
 AtREG496CAAACCGG   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG436 AAACCGGT  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG552  AACCGGTC PPDB MotifAACCG(G/A)  PLACE Motif 
REGAAAGTCAA+2429472724294734-499-492
 AtREG632AAAGTCAA PPDB Motif  PLACE MotifTTGAC 
REGACACGTCA+2429473724294744-489-482
 AtREG517ACACGTCAABA PPDB MotifACGT  PLACE MotifACGT, ACGTG 
REGCACGTGAC+2429476924294776-457-450
 AtREG583CACGTGAC PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG 
REGTTAAACCGGAT+2429481324294823-413-403
 AtREG473TTAAACCG    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG412 TAAACCGG   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG521  AAACCGGA  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG561   AACCGGAT PPDB MotifAACCG(G/A)  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.