version
PlantPromoterDB promoter information of AT5G61380

Summary of Gene (AT5G61380)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G61380  TAIR      NCBI 
Gene model AT5G61380  
Description Pseudo response regulator involved in the generation of circadian rhythms. TOC1 appears to shorten the period of circumnutation speed. TOC1 contributes to the plant fitness (carbon fixation, biomass) by influencing the circadian clock period. PRR3 may increase the stability of TOC1 by preventing interactions between TOC1 and the F-box protein ZTL. Expression of TOC1 is correlated with rhythmic changes in chromatin organization.  
#
#

Overview

Focused view (chromosome 5: 24674540-24675739)

Genome position     
from initiation codon
AT5G61380.1         
TSS from cDNA
TSS information
AT5G61380                        5'->3' (+)
Promoter sequence






 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G61380

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA17+24675084-456

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone+24675085-455
TSS cloneGclone+24675087-453
TSS cloneCclone+24675107-433

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTCTCTTT+2467503524675042-505-498
Y PatchTCTTTCTCTTCTC+2467509324675105-447-435
Y PatchCTCTTCTT+2467510724675114-433-426
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGATGACGTGGCCTTTT+2467482724674842-713-698
 AtREG578GATGACGT        ABA PPDB MotifACGT  PLACE MotifACGT 
 AtREG483 ATGACGTG        PPDB MotifACGT  PLACE MotifACGT, ACGTG 
 AtREG419  TGACGTGG       PPDB MotifACGT  PLACE MotifACGT, ACGTG, TGACGTGG, CCACGTCA 
 AtREG388   GACGTGGC      PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, ACGTGKC 
 AtREG459        GGCCTTTT PPDB Motif  PLACE Motif 
REGGTCCACGTCATC+2467490224674913-638-627
 AtREG513GTCCACGT    ABA, DREB1Aox PPDB MotifACGT  PLACE MotifACGT, ACGTG 
 AtREG419  CCACGTCA   PPDB MotifACGT  PLACE MotifACGT, ACGTG, TGACGTGG, CCACGTCA 
 AtREG483   CACGTCAT  PPDB MotifACGT  PLACE MotifACGT, ACGTG 
 AtREG578    ACGTCATCABA PPDB MotifACGT  PLACE MotifACGT 
REGGGCCTAAA+2467491924674926-621-614
 AtREG430GGCCTAAA PPDB Motif  PLACE Motif 
REGCCATTAAG+2467494224674949-598-591
 AtREG604CCATTAAG PPDB Motif  PLACE MotifTTAATGG 
REGCAACGGTC+2467500824675015-532-525
 AtREG553CAACGGTCAuxin PPDB MotifCCAACGG  PLACE MotifYAACKG, CNGTTR 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.