version
PlantPromoterDB promoter information of AT5G63510.1

Summary of Gene (AT5G63510.1)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G63510  TAIR      NCBI 
Gene model AT5G63510.1  
Description Encodes a mitochondrial gamma carbonic anhydrase-like protein. Component of the NADH dehydrogenase complex.  
#
#

Overview

Focused view (chromosome 5: 25423054-25424253)

Genome position     
from initiation codon
AT5G63500.1         
TSS from cDNA
TSS information
AT5G63510.1                      5'->3' (+)
Promoter sequence








 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G63510.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG46+25424021-33

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneCclone+25423408-646
TSS cloneTclone+25423411-643
TSS cloneTclone+25423419-635
TSS cloneTclone+25424004-50
TSS cloneTclone+25424010-44
TSS cloneTclone+25424049-5

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTCTCTCTCTTT+2542400125424012-53-42
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGAAACGACGACGT+2542390525423917-149-137
 AtREG576GAAACGAC      PPDB Motif  PLACE Motif 
 AtREG415 AAACGACG     PPDB Motif  PLACE Motif 
 AtREG648  AACGACGA    PPDB Motif  PLACE Motif 
 AtREG526     GACGACGT PPDB MotifACGT  PLACE MotifACGT 
REGTTATTGGGCCTGT+2542392525423937-129-117
 AtREG417TTATTGGG      PPDB MotifGCCCA  PLACE Motif 
 AtREG355 TATTGGGC     PPDB MotifGCCCA  PLACE Motif 
 AtREG352  ATTGGGCC    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG356   TTGGGCCT   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG370    TGGGCCTG  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG433     GGGCCTGT PPDB MotifGCCCA  PLACE MotifGGGCC 
REGCCGTTAAAAAGCCCAATAT+2542394125423959-113-95
 AtREG610CCGTTAAA            PPDB Motif  PLACE MotifYAACKG, CNGTTR 
 AtREG589     AAAAAGCC       PPDB Motif  PLACE Motif 
 AtREG409      AAAAGCCC      PPDB MotifGCCCA  PLACE Motif 
 AtREG376       AAAGCCCA     PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407        AAGCCCAA    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG402         AGCCCAAT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG355          GCCCAATA  PPDB MotifGCCCA  PLACE Motif 
 AtREG509           CCCAATAT PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.