version
PlantPromoterDB promoter information of AT5G63650

Summary of Gene (AT5G63650)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G63650  TAIR      NCBI 
Gene model AT5G63650  
Description encodes a member of SNF1-related protein kinases (SnRK2) whose activity is activated by ionic (salt) and non-ionic (mannitol) osmotic stress.  
#
#

Overview

Focused view (chromosome 5: 25488095-25486896)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT5G63650                        5'->3' (-)
Promoter sequence

 
AT5G63670.1         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence












 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G63650

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA10-25483584-89

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneTclone-25483715-220
TSS cloneAclone-25483584-89

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxCTTTATAA-2548361125483618-116-123
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCGTTGGAT-2548380125483809-306-314
 AtREG554CCGTTGGA  PPDB MotifCCAACGG  PLACE MotifYAACKG, CNGTTR 
 AtREG586 CGTTGGAT PPDB MotifCCAACGG  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakG30+25487994AT5G63670.1

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneGclone+25487981AT5G63670.1
TSS cloneGclone+25487982AT5G63670.1
TSS cloneTclone+25487989AT5G63670.1
TSS cloneGclone+25487991AT5G63670.1
TSS cloneAclone+25487995AT5G63670.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGAAAGTCAA+2548783325487840AT5G63670.1
 AtREG632AAAGTCAA PPDB Motif  PLACE MotifTTGAC 
REGTTAAAGCCCATA+2548789325487904AT5G63670.1
 AtREG545TTAAAGCC     PPDB Motif  PLACE Motif 
 AtREG365 TAAAGCCC    PPDB MotifGCCCA  PLACE Motif 
 AtREG376  AAAGCCCA   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378   AAGCCCAT  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG477    AGCCCATA PPDB MotifGCCCA  PLACE MotifTGGGCY 
REGTAAAAGCCCAAATACGGCCCAATAA+2548790725487931AT5G63670.1
 AtREG549TAAAAGCC                  PPDB Motif  PLACE Motif 
 AtREG409 AAAAGCCC                 PPDB MotifGCCCA  PLACE Motif 
 AtREG376  AAAGCCCA                PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407   AAGCCCAA               PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG469    AGCCCAAA              PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG421     GCCCAAAT             PPDB MotifGCCCA  PLACE Motif 
 AtREG499            TACGGCCC      PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG368             ACGGCCCA     PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG414              CGGCCCAA    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG352               GGCCCAAT   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG355                GCCCAATA  PPDB MotifGCCCA  PLACE Motif 
 AtREG417                 CCCAATAA PPDB MotifGCCCA  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.