version
PlantPromoterDB promoter information of AT5G63870.3

Summary of Gene (AT5G63870.3)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G63870  TAIR      NCBI 
Gene model AT5G63870.3  
Description Encodes a nuclear localized serine/threonine phosphatase that appears to be regulated by redox activity and is a positive regulator of cryptochrome mediated blue light signalling.  
#
#

Overview

Focused view (chromosome 5: 25563908-25562709)

Genome position     
from initiation codon
AT5G63870.1         
AT5G63870.2         
TSS from cDNA
TSS information
AT5G63870.3                      5'->3' (-)
Promoter sequence




 
AT5G63880.1         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G63870.3

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG8-25563264-356

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone-25563274-366
TSS cloneCclone-25563248-340
TSS cloneTclone-25563247-339
TSS cloneGclone-25563242-334

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGACGTCGTTT-2556330625563315-398-407
 AtREG431GACGTCGT   PPDB MotifACGT  PLACE MotifACGT 
 AtREG493 ACGTCGTT  PPDB MotifACGT  PLACE MotifACGT 
 AtREG415  CGTCGTTT PPDB Motif  PLACE Motif 
REGTTAAACCGGCCGGTTTGG-2556335525563372-447-464
 AtREG473TTAAACCG           PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG412 TAAACCGG          PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG496         CCGGTTTG  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG550          CGGTTTGG PPDB MotifAACCG(G/A)  PLACE Motif 
REGCAAAACGC-2556341025563417-502-509
 AtREG585CAAAACGC PPDB MotifAAACG(C/G)  PLACE MotifCAAAACGC 
REGAGCGCGTGA-2556342125563429-513-521
 AtREG381AGCGCGTG  PPDB MotifACGCGC  PLACE Motif 
 AtREG395 GCGCGTGA PPDB MotifACGCGC  PLACE Motif 
REGCGCGTTTT-2556343425563441-526-533
 AtREG566CGCGTTTT PPDB MotifAAACG(C/G)  PLACE Motif 
REGCAAACCGGT-2556346925563477-561-569
 AtREG496CAAACCGG  PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG436 AAACCGGT PPDB MotifAACCG(G/A)  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS clone peakGclone+25563733AT5G63880.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.