version
PlantPromoterDB promoter information of AT5G64180

Summary of Gene (AT5G64180)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G64180  TAIR      NCBI 
Gene model AT5G64180  
Description unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; EXPRESSED IN: 21 plant structures; EXPRESSED DURING: 13 growth stages; Has 181 Blast hits to 181 proteins in 61 species: Archae - 0; Bacteria - 5; Metazoa - 125; Fungi - 11; Plants - 24; Viruses - 0; Other Eukaryotes - 16 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 5: 25676163-25677362)

Genome position     
from initiation codon
AT5G64180.1         
TSS from cDNA
TSS information
AT5G64180                        5'->3' (+)
Promoter sequence





 
AT5G64170.1         
AT5G64170.2         
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence





 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G64180

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA5+25677083-80

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneGclone+25677084-79
TSS cloneAclone+25677096-67

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAACACGTGGCAA+2567681825676829-345-334
 AtREG590AACACGTG    ABA, JA PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG, ACACNNG 
 AtREG382 ACACGTGG   ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG, ACACNNG 
 AtREG367  CACGTGGC  ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, CACGTG, ACGTGKC, CACGTGGC 
 AtREG379   ACGTGGCA ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, ACGTGKC 
 AtREG452    CGTGGCAA PPDB Motif  PLACE MotifGCCAC 
REGGTACACGTCAT+2567692525676935-238-228
 AtREG562GTACACGT   ABA, Auxin PPDB MotifACGT  PLACE MotifACGT, ACGTG 
 AtREG517  ACACGTCA ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG 
 AtREG483   CACGTCAT PPDB MotifACGT  PLACE MotifACGT, ACGTG 
REGCTTATTGG+2567697025676977-193-186
 AtREG611CTTATTGG PPDB Motif  PLACE Motif 
REGCGGTTAAA+2567703125677038-132-125
 AtREG645CGGTTAAA PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakA8-25676729AT5G64170.2

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneGclone-25676746AT5G64170.2
TSS cloneCclone-25676687AT5G64170.2
TSS cloneTclone-25676686AT5G64170.2

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCGTCTTCT-2567670925676716AT5G64170.2
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGTTGCCACGTGTT-2567681825676829AT5G64170.2
 AtREG452TTGCCACG     PPDB Motif  PLACE MotifGCCAC 
 AtREG379 TGCCACGT   ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, ACGTGKC 
 AtREG367  GCCACGTG  ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, GCCAC, CACGTG, ACGTGKC, CACGTGGC 
 AtREG382   CCACGTGT ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG, ACACNNG 
 AtREG590    CACGTGTTABA, JA PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG, ACACNNG 
REGATGACGTGTAC-2567692525676935AT5G64170.2
 AtREG483ATGACGTG    PPDB MotifACGT  PLACE MotifACGT, ACGTG 
 AtREG517 TGACGTGT  ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG 
 AtREG562   ACGTGTACABA, Auxin PPDB MotifACGT  PLACE MotifACGT, ACGTG 
REGCCAATAAG-2567697025676977AT5G64170.2
 AtREG611CCAATAAG PPDB Motif  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.