version
PlantPromoterDB promoter information of AT5G65110.2

Summary of Gene (AT5G65110.2)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G65110  TAIR      NCBI 
Gene model AT5G65110.2  
Description Encodes an acyl-CoA oxidase presumably involved in long chain fatty acid biosynthesis.  
#
#

Overview

Focused view (chromosome 5: 26013482-26012283)

Genome position     
from initiation codon
AT5G65110.1         
TSS from cDNA
TSS information
AT5G65110.2                      5'->3' (-)
Promoter sequence









 
AT5G65120.1         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G65110.2

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA10-26012493-11

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone-26012519-37
TSS cloneTclone-26012513-31
TSS cloneAclone-26012502-20
TSS cloneAclone-26012500-18
TSS cloneAclone-26012492-10
TSS cloneTclone-26012487-5

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxCCTTTATAA-2601252826012536-46-54
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAACGACGTGTCCACGTCATC-2601255926012578-77-96
 AtREG493AACGACGT             PPDB MotifACGT  PLACE MotifACGT 
 AtREG481   GACGTGTC         ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, ACGTGKC, ACGTGTC 
 AtREG472    ACGTGTCC        ABA, DREB1Aox, Drought PPDB MotifACGT  PLACE MotifACGT, ACGTG, ACGTGKC, ACGTGTC 
 AtREG513        GTCCACGT    ABA, DREB1Aox PPDB MotifACGT  PLACE MotifACGT, ACGTG 
 AtREG419          CCACGTCA   PPDB MotifACGT  PLACE MotifACGT, ACGTG, TGACGTGG, CCACGTCA 
 AtREG483           CACGTCAT  PPDB MotifACGT  PLACE MotifACGT, ACGTG 
 AtREG578            ACGTCATCABA PPDB MotifACGT  PLACE MotifACGT 
REGACACGTCAT-2601258326012591-101-109
 AtREG517ACACGTCA ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG 
 AtREG483 CACGTCAT PPDB MotifACGT  PLACE MotifACGT, ACGTG 
REGATAAAGCCCAAAAGCCCAC-2601274126012759-259-277
 AtREG601ATAAAGCC            PPDB Motif  PLACE Motif 
 AtREG365 TAAAGCCC           PPDB MotifGCCCA  PLACE Motif 
 AtREG376  AAAGCCCAAAAGCCCA  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG407   AAGCCCAA         PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG469    AGCCCAAA        PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG529     GCCCAAAA       PPDB MotifGCCCA  PLACE Motif 
 AtREG409         AAAAGCCC   PPDB MotifGCCCA  PLACE Motif 
 AtREG518           AAGCCCAC PPDB MotifGCCCA  PLACE MotifTGGGCY 
REGCTTAATGGGCCAC-2601278126012793-299-311
 AtREG604CTTAATGG      PPDB Motif  PLACE MotifTTAATGG 
 AtREG396 TTAATGGG     PPDB MotifGCCCA  PLACE MotifTTAATGG 
 AtREG357  TAATGGGC    PPDB MotifGCCCA  PLACE Motif 
 AtREG361   AATGGGCC   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG490    ATGGGCCA  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG445     TGGGCCAC PPDB MotifGCCCA  PLACE MotifGCCAC, GGGCC, TGGGCY 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.