version
PlantPromoterDB promoter information of AT5G65210.1

Summary of Gene (AT5G65210.1)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G65210  TAIR      NCBI 
Gene model AT5G65210.1  
Description TGA1; FUNCTIONS IN: transcription factor activity, calmodulin binding, DNA binding; INVOLVED IN: defense response to bacterium; LOCATED IN: nucleus; EXPRESSED IN: 17 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Basic-leucine zipper (bZIP) transcription factor (InterPro:IPR004827), bZIP transcription factor, bZIP-1 (InterPro:IPR011616); BEST Arabidopsis thaliana protein match is: TGA4 (TGACG MOTIF-BINDING FACTOR 4); DNA binding / calmodulin binding / transcription factor (TAIR:AT5G10030.1); Has 474 Blast hits to 473 proteins in 39 species: Archae - 0; Bacteria - 0; Metazoa - 6; Fungi - 0; Plants - 439; Viruses - 0; Other Eukaryotes - 29 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 5: 26058031-26059230)

Genome position     
from initiation codon
AT5G65210.2         
AT5G65210.3         
AT5G65210.4         
AT5G65210.5         
AT5G65210.6         
TSS from cDNA
TSS information
AT5G65210.1                      5'->3' (+)
Promoter sequence

 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G65210.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+26058542-489

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGNoneNoneNone

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakG8+26059111AT5G65210.6

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGTTGACTTT+2605889426058901AT5G65210.6
 AtREG632TTGACTTT PPDB Motif  PLACE MotifTTGAC 
REGCGACATCG+2605903826059045AT5G65210.6
 AtREG630CGACATCG PPDB Motif  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.