version
PlantPromoterDB promoter information of AT5G66120.1

Summary of Gene (AT5G66120.1)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G66120  TAIR      NCBI 
Gene model AT5G66120.1  
Description 3-dehydroquinate synthase, putative; FUNCTIONS IN: 3-dehydroquinate synthase activity; INVOLVED IN: aromatic amino acid family biosynthetic process; LOCATED IN: chloroplast; EXPRESSED IN: 23 plant structures; EXPRESSED DURING: 14 growth stages; CONTAINS InterPro DOMAIN/s: 3-dehydroquinate synthase AroB, subgroup (InterPro:IPR016037), 3-dehydroquinate synthase AroB (InterPro:IPR002658); Has 5882 Blast hits to 5880 proteins in 1401 species: Archae - 124; Bacteria - 2775; Metazoa - 7; Fungi - 133; Plants - 27; Viruses - 2; Other Eukaryotes - 2814 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 5: 26434079-26432880)

Genome position     
from initiation codon
AT5G66120.2         
TSS from cDNA
TSS information
AT5G66120.1                      5'->3' (-)
Promoter sequence





 
AT5G66130.1         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence





 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G66120.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakA8-26433778-699

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneTclone-26433755-676
TSS cloneAclone-26433738-659
TSS cloneGclone-26433733-654

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCGTGACGTGTCA-2643391126433922-832-843
 AtREG489CGTGACGT    ABA, DREB1Aox PPDB MotifACGT  PLACE MotifACGT 
 AtREG466 GTGACGTG   ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG 
 AtREG517  TGACGTGT  ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG 
 AtREG481   GACGTGTC ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, ACGTGKC, ACGTGTC 
 AtREG389    ACGTGTCAABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, ACGTGKC, ACGTGTC 
REGAAACGGCA-2643397126433978-892-899
 AtREG500AAACGGCA PPDB MotifAAACG(C/G)  PLACE Motif 
REGCGCGTTTT-2643405726434064-978-985
 AtREG566CGCGTTTT PPDB MotifAAACG(C/G)  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGTGACACGTCACG+2643391126433922AT5G66130.1
 AtREG389TGACACGT    ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, ACGTGKC, ACGTGTC 
 AtREG481 GACACGTC   ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG, ACGTGKC, ACGTGTC 
 AtREG517  ACACGTCA  ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG 
 AtREG466   CACGTCAC ABA PPDB MotifACGT  PLACE MotifACGT, ACGTG 
 AtREG489    ACGTCACGABA, DREB1Aox PPDB MotifACGT  PLACE MotifACGT 
REGTGCCGTTT+2643397126433978AT5G66130.1
 AtREG500TGCCGTTT PPDB MotifAAACG(C/G)  PLACE Motif 
REGAAAACGCG+2643405726434064AT5G66130.1
 AtREG566AAAACGCG PPDB MotifAAACG(C/G)  PLACE Motif 
REGACGACACGCCGTT+2643407226434084AT5G66130.1
 AtREG428ACGACACG     ABA, DREB1Aox, Ethylene, Drought PPDB Motif  PLACE Motif 
 AtREG497     ACGCCGTT PPDB MotifAAACG(C/G), CCAACGG  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.