version
PlantPromoterDB promoter information of AT5G66150.1

Summary of Gene (AT5G66150.1)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G66150  TAIR      NCBI 
Gene model AT5G66150.1  
Description glycosyl hydrolase family 38 protein; FUNCTIONS IN: in 6 functions; INVOLVED IN: mannose metabolic process, carbohydrate metabolic process; LOCATED IN: endomembrane system; EXPRESSED IN: sperm cell, leaf whorl, petal, flower; EXPRESSED DURING: 4 anthesis, petal differentiation and expansion stage; CONTAINS InterPro DOMAIN/s: Glycoside hydrolase-type carbohydrate-binding (InterPro:IPR011013), Glycoside hydrolase/deacetylase, beta/alpha-barrel (InterPro:IPR011330), Glycoside hydrolase, family 38, central region (InterPro:IPR015341), Glycoside hydrolase, family 38, core (InterPro:IPR000602), Glycosyl hydrolases 38, C-terminal (InterPro:IPR011682); BEST Arabidopsis thaliana protein match is: glycosyl hydrolase family 38 protein (TAIR:AT3G26720.1); Has 1123 Blast hits to 1086 proteins in 215 species: Archae - 8; Bacteria - 257; Metazoa - 604; Fungi - 50; Plants - 73; Viruses - 0; Other Eukaryotes - 131 (source: NCBI BLink).  
#
#

Overview

Focused view (chromosome 5: 26445434-26444235)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
AT5G66150.1                      5'->3' (-)
Promoter sequence

 
AT5G66160.1         
AT5G66160.2         
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence




 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G66150.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGNoneNoneNone

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakC4+26445116AT5G66160.2, AT5G66160.1

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneCclone+26445134AT5G66160.2, AT5G66160.1
TSS cloneGclone+26445151AT5G66160.2, AT5G66160.1
TSS cloneAclone+26445190AT5G66160.2, AT5G66160.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTTCTCTCT+2644511026445117AT5G66160.1, AT5G66160.2
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGACGTCGTCGTTTT+2644503426445046AT5G66160.1, AT5G66160.2
 AtREG526ACGTCGTC      PPDB MotifACGT  PLACE MotifACGT 
 AtREG648   TCGTCGTT   PPDB Motif  PLACE Motif 
 AtREG415    CGTCGTTT  PPDB Motif  PLACE Motif 
 AtREG520     GTCGTTTT PPDB Motif  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.