version
PlantPromoterDB promoter information of AT5G67320.1

Summary of Gene (AT5G67320.1)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G67320  TAIR      NCBI 
Gene model AT5G67320.1  
Description Encodes a WD-40 protein involved in histone deacetylation in response to abiotic stress.Identified in a screen for mutations with altered expression of stress induced genes. Functions as a repressor of cold tolerance induced genes. Loss of function mutants are hypersensitive to freezing.  
#
#

Overview

Focused view (chromosome 5: 26853868-26855067)

Genome position     
from initiation codon
AT5G67300.1         
TSS from cDNA
TSS information
AT5G67320.1                      5'->3' (+)
Promoter sequence








 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G67320.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG8+26857195-73

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneGclone+26857154-114
TSS cloneAclone+26857157-111
TSS cloneAclone+26857176-92

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTCTTTCTCC+2685721026857219-58-49
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGTTGGGCCGAA+2685704426857054-224-214
 AtREG449GTTGGGCC    PPDB MotifGCCCA, CCAACGG  PLACE MotifGGGCC, TGGGCY 
 AtREG414 TTGGGCCG   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG393  TGGGCCGA  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG427   GGGCCGAA PPDB MotifGCCCA  PLACE MotifGGGCC 
REGATAGGCCCATTA+2685707826857089-190-179
 AtREG362ATAGGCCC     PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG358 TAGGCCCA    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG354  AGGCCCAT   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG361   GGCCCATT  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG357    GCCCATTA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakG95+26854025AT5G67300.1

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneTclone+26854023AT5G67300.1
TSS cloneGclone+26854025AT5G67300.1
TSS cloneAclone+26854026AT5G67300.1
TSS cloneAclone+26854027AT5G67300.1
TSS cloneTclone+26854032AT5G67300.1
TSS cloneGclone+26854038AT5G67300.1
TSS cloneTclone+26854043AT5G67300.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxTGTATAAATA+2685399126854000AT5G67300.1
Y PatchCCTCTCTT+2685397626853983AT5G67300.1
Y PatchTCCTCTCTTT+2685400726854016AT5G67300.1
Y PatchCATCTCTC+2685404126854048AT5G67300.1
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGACGCGTGT+2685387126853878AT5G67300.1
 AtREG536ACGCGTGTABA, Drought PPDB Motif  PLACE MotifACACNNG 
REGCTTAACCGGTTTCCGGTTAT+2685395326853972AT5G67300.1
 AtREG605CTTAACCG             PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
 AtREG501 TTAACCGG            PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
 AtREG503  TAACCGGT           PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
 AtREG436    ACCGGTTT         PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG644         TTTCCGGT    PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG534          TTCCGGTT   PPDB MotifAACCG(G/A)  PLACE Motif 
 AtREG621           TCCGGTTA  PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 
 AtREG548            CCGGTTAT PPDB MotifAACCG(G/A)  PLACE MotifCNGTTR 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.