version
PlantPromoterDB promoter information of AT5G67500.1

Summary of Gene (AT5G67500.1)

Organism Arabidopsis thaliana  
Chromosome 5  
Locus AT5G67500  TAIR      NCBI 
Gene model AT5G67500.1  
Description Encodes a voltage-dependent anion channel (VDAC: AT3G01280/VDAC1, AT5G67500/VDAC2, AT5G15090/VDAC3, AT5G57490/VDAC4, AT5G15090/VDAC5). VDACs are reported to be porin-type, beta-barrel diffusion pores. They are prominently localized in the outer mitochondrial membrane and are involved in metabolite exchange between the organelle and the cytosol.  
#
#

Overview

Focused view (chromosome 5: 26933873-26935072)

Genome position     
from initiation codon
AT5G67488           
AT5G67488.1         
TSS from cDNA
TSS information
AT5G67500.1                      5'->3' (+)
Promoter sequence




 
AT5G67488.1         
AT5G67490.1         
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence






 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of AT5G67500.1

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakG5+26934651-572
TSS peakG74+26935163-60

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone+26934358-865
TSS cloneTclone+26935164-59
TSS cloneTclone+26935170-53
TSS cloneAclone+26935174-49

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTCTCTC+2693520026935207-23-16
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGAGTCGGTT+2693441326934420-810-803
 AtREG641AGTCGGTT PPDB MotifAACCG(G/A), CCGAC  PLACE MotifCCGAC, RCCGAC 
REGCTAGGCCC+2693442926934436-794-787
 AtREG475CTAGGCCC PPDB MotifGCCCA  PLACE MotifGGGCC 
REGCCGGTTCA+2693455426934561-669-662
 AtREG480CCGGTTCA PPDB MotifAACCG(G/A)  PLACE Motif 
REGTTGGCCCAGTA+2693486926934879-354-344
 AtREG484TTGGCCCA    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG458 TGGCCCAG   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG384  GGCCCAGT  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG434   GCCCAGTA PPDB MotifGCCCA  PLACE Motif 
REGCAAGCCCATCA+2693489326934903-330-320
 AtREG525CAAGCCCA    PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG378 AAGCCCAT   PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG635   GCCCATCA PPDB MotifGCCCA  PLACE Motif 
REGGGCCTAAC+2693491126934918-312-305
 AtREG535GGCCTAAC PPDB Motif  PLACE Motif 
REGTGACGTGGGCTGA+2693495926934971-264-252
 AtREG419TGACGTGG      PPDB MotifACGT  PLACE MotifACGT, ACGTG, TGACGTGG, CCACGTCA 
 AtREG609     TGGGCTGA PPDB MotifGCCCA  PLACE MotifTGGGCY 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
TSS peakG13-26934721AT5G67490.1

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS cloneTclone-26934729AT5G67490.1
TSS cloneTclone-26934727AT5G67490.1
TSS cloneCclone-26934724AT5G67490.1
TSS cloneGclone-26934721AT5G67490.1
TSS cloneGclone-26934715AT5G67490.1
TSS cloneCclone-26934710AT5G67490.1

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCTCTTTCT-2693472326934731AT5G67490.1
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGTATGGCCCAAC-2693477926934789AT5G67490.1
 AtREG479TATGGCCC    PPDB MotifGCCCA  PLACE MotifGGGCC 
 AtREG437 ATGGCCCA   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG420  TGGCCCAA  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG449   GGCCCAAC PPDB MotifGCCCA, CCAACGG  PLACE MotifGGGCC, TGGGCY 
REGTACTGGGCTTAT-2693479826934809AT5G67490.1
 AtREG434TACTGGGC     PPDB MotifGCCCA  PLACE Motif 
 AtREG426   TGGGCTTA  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG462    GGGCTTAT PPDB MotifGCCCA  PLACE Motif 
REGATTGGGCCTAG-2693481426934824AT5G67490.1
 AtREG352ATTGGGCC    PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG356 TTGGGCCT   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG358  TGGGCCTA  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG475   GGGCCTAG PPDB MotifGCCCA  PLACE MotifGGGCC 
REGTACTGGGCCAA-2693486926934879AT5G67490.1
 AtREG434TACTGGGC    PPDB MotifGCCCA  PLACE Motif 
 AtREG384 ACTGGGCC   PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG458  CTGGGCCA  PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG484   TGGGCCAA PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
REGTGATGGGCTTG-2693489326934903AT5G67490.1
 AtREG635TGATGGGC    PPDB MotifGCCCA  PLACE Motif 
 AtREG378  ATGGGCTT  PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG525   TGGGCTTG PPDB MotifGCCCA  PLACE MotifTGGGCY 
REGGTTAGGCC-2693491126934918AT5G67490.1
 AtREG535GTTAGGCC PPDB Motif  PLACE Motif 
REGTCAGCCCACGTCA-2693495926934971AT5G67490.1
 AtREG609TCAGCCCA      PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG419     CCACGTCA PPDB MotifACGT  PLACE MotifACGT, ACGTG, TGACGTGG, CCACGTCA 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.