version
PlantPromoterDB promoter information of ATMG01370

Summary of Gene (ATMG01370)

Organism Arabidopsis thaliana  
Chromosome M  
Locus ATMG01370  TAIR      NCBI 
Gene model ATMG01370  
Description hypothetical protein  
#
#

Overview

Focused view (chromosome M: 362052-360853)

Genome position     
from initiation codon
ATMG01370.1         
ATMG01380           
ATMG01380.1         
ATMG01390           
ATMG01390.1         
TSS from cDNA
TSS information
ATMG01370                        5'->3' (-)
Promoter sequence






 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
TSS tag distribution(+)











TSS tag distribution(-)











ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of ATMG01370

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS peakC4-361797-745
TSS peakG4-361650-598
TSS peakA4-361081-29

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCAAACCGG-361173361180-121-128
 AtREG496CAAACCGG PPDB MotifAACCG(G/A)  PLACE Motif 
REGGGGCTTTT-361267361274-215-222
 AtREG409GGGCTTTT PPDB MotifGCCCA  PLACE Motif 
REGGCCCTTATGGGCTGGGCCACACACGTG-361702361728-650-676
 AtREG616GCCCTTAT                    PPDB Motif  PLACE Motif 
 AtREG394    TTATGGGC                PPDB MotifGCCCA  PLACE Motif 
 AtREG477     TATGGGCT               PPDB MotifGCCCA  PLACE MotifTGGGCY 
 AtREG454         GGCTGGGC           PPDB MotifGCCCA  PLACE Motif 
 AtREG458           CTGGGCCA         PPDB MotifGCCCA  PLACE MotifGGGCC, TGGGCY 
 AtREG445            TGGGCCAC        PPDB MotifGCCCA  PLACE MotifGCCAC, GGGCC, TGGGCY 
 AtREG460                   CACACGTGABA, DREB1Aox PPDB MotifACGT  PLACE MotifACGT, ACGTG, CACGTG, ACACNNG 
REGGATGACGT-361741361748-689-696
 AtREG578GATGACGTABA PPDB MotifACGT  PLACE MotifACGT 
REGAAAACGGC-361819361826-767-774
 AtREG531AAAACGGC PPDB MotifAAACG(C/G)  PLACE Motif 
REGGACGACGTC-361911361919-859-867
 AtREG526GACGACGT  PPDB MotifACGT  PLACE MotifACGT 
 AtREG431 ACGACGTC PPDB MotifACGT  PLACE MotifACGT 
REGTTTGACCC-361927361934-875-882
 AtREG592TTTGACCC PPDB Motif  PLACE MotifTTGAC, TTGACC 
REGAAAGTCAA-361938361945-886-893
 AtREG632AAAGTCAA PPDB Motif  PLACE MotifTTGAC 
REGGGGCTTTT-361960361967-908-915
 AtREG409GGGCTTTT PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.