version
PlantPromoterDB promoter information of 003-106-C01

Summary of Gene (003-106-C01)

Organism Oryza sativa  
Chromosome 11  
Locus Os11g0707000        NCBI 
Gene model 003-106-C01  
Description NONE  
#
#

Overview

Focused view (chromosome 11: 30741565-30740366)

Genome position     
from initiation codon
003-130-G06         
005-012-E05         
006-021-F04         
006-043-G08         
006-118-E05         
AK058310            
AK104332            
AK119513            
J013024I02          
J013048O10          
J013096P16          
J013109A14          
J013159L01          
J023013G12          
J023020K06          
J023034A05          
J023034E21          
J023041M12          
J023041P06          
J023063G11          
J023068O21          
J023089K10          
J023100O05          
J023107N16          
J023120L08          
J023123N23          
J023128C22          
J023129C04          
J023146H08          
J053066F02          
J053066N18          
J053076G01          
J065012O05          
J065037M01          
J065045N23          
J065058F09          
J065072E14          
J065073I20          
J065093B09          
J065149J21          
J065155M04          
J075028F20          
J075123E10          
J075141B05          
J075169H18          
J080084D09          
J080305J21          
J080310E21          
J090032M14          
J090045I12          
J090076M15          
TSS from cDNA
TSS information
003-106-C01                      5'->3' (-)
Promoter sequence

 
Os11g0706800        
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of 003-106-C01

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-30744593-628
TSS clone peakAclone-30744278-313

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCGTTGGA-3074450230744509-537-544
 OsREG548CCGTTGGA PPDB MotifCCAACGG  PLACE Motif 
REGCGTGTGGC-3074471930744726-754-761
 OsREG573CGTGTGGC PPDB Motif  PLACE Motif 
REGCGCCACGTGT-3074474530744754-780-789
 OsREG448CGCCACGT   PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG507 GCCACGTG  PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG434  CCACGTGT PPDB MotifACGT  PLACE Motif 
REGGGCCGAGAT-3074475730744765-792-800
 OsREG635GGCCGAGA  PPDB Motif  PLACE Motif 
 OsREG485 GCCGAGAT PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.