version
PlantPromoterDB promoter information of 003-107-B06

Summary of Gene (003-107-B06)

Organism Oryza sativa  
Chromosome 2  
Locus Os02g0626100        NCBI 
Gene model 003-107-B06  
Description NONE  
#
#

Overview

Focused view (chromosome 2: 25876051-25874852)

Genome position     
from initiation codon
AK120127            
J013026F02          
J013074E15          
J013106F17          
J065138F20          
J065155D15          
J065188C03          
J065193M01          
J065207N22          
J090046M04          
J090048K05          
J090051M23          
J090054K01          
J090058D22          
J090078I12          
J090079A20          
J090079J17          
J090082P08          
J090084A18          
J100029M17          
J100059G03          
J100071N05          
TSS from cDNA
TSS information
003-107-B06                      5'->3' (-)
Promoter sequence

 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of 003-107-B06

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-25876249-148

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCCCACAC-2587633025876337-229-236
 OsREG535CCCCACAC PPDB Motif  PLACE Motif 
REGATCCGACGG-2587636925876377-268-276
 OsREG483ATCCGACG  PPDB MotifCCGAC  PLACE MotifCGACG 
 OsREG546 TCCGACGG PPDB MotifCCGAC  PLACE MotifCGACG 
REGCAGGTGGGCCACGCGTCGCG-2587641225876431-311-330
 OsREG514CAGGTGGG             PPDB MotifGCCCA  PLACE Motif 
 OsREG476 AGGTGGGC            PPDB MotifGCCCA  PLACE Motif 
 OsREG628  GGTGGGCC           PPDB MotifGCCCA  PLACE Motif 
 OsREG654   GTGGGCCA          PPDB MotifGCCCA  PLACE Motif 
 OsREG653    TGGGCCAC         PPDB MotifGCCCA  PLACE Motif 
 OsREG443        CCACGCGT     PPDB Motif  PLACE Motif 
 OsREG559           CGCGTCGC  PPDB Motif  PLACE MotifCGACG 
 OsREG556            GCGTCGCG PPDB Motif  PLACE MotifCGACG 
REGCCTCGCCC-2587647225876479-371-378
 OsREG549CCTCGCCC PPDB MotifGCCCA  PLACE Motif 
REGCGGCTCGG-2587648225876489-381-388
 OsREG540CGGCTCGG PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.