version
PlantPromoterDB promoter information of 004-008-D07

Summary of Gene (004-008-D07)

Organism Oryza sativa  
Chromosome 1  
Locus Os01g0612600        NCBI 
Gene model 004-008-D07  
Description NONE  
#
#

Overview

Focused view (chromosome 1: 25942153-25940954)

Genome position     
from initiation codon
009-057-C09         
009-130-C01         
AK062906            
AK066561            
J013065E14          
J013073D14          
J023014A21          
J023073M13          
J023079F02          
J023083B16          
J023090G19          
J023095F15          
J023119H11          
J033040B01          
J033044F13          
J033081E23          
J033121K07          
J033124D11          
J033131N22          
J065179E10          
J090020A13          
J090045K17          
J090047M24          
J090064G23          
J090084G08          
J090086F18          
J100032D09          
J100037O18          
J100042B03          
J100061D06          
J100061I03          
J100063B17          
TSS from cDNA
TSS information
004-008-D07                      5'->3' (-)
Promoter sequence











 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of 004-008-D07

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakCclone-25942146-993

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxATATAAAG-2594217825942185-1025-1032
Y PatchTTCCCCTCCTTCCTCCTCCCCTT-2594210525942127-952-974
Y PatchCCTCCCTCTCTCTC-2594214425942157-991-1004
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCACGTCAC-2594219825942205-1045-1052
 OsREG505CACGTCAC PPDB MotifACGT  PLACE MotifTGAC 
REGCACGTCAC-2594221025942217-1057-1064
 OsREG505CACGTCAC PPDB MotifACGT  PLACE MotifTGAC 
REGTGCGGGCCGGGCCG-2594224125942254-1088-1101
 OsREG632TGCGGGCC       PPDB Motif  PLACE Motif 
 OsREG538   GGGCCGGG    PPDB MotifGCCCA  PLACE Motif 
 OsREG614    GGCCGGGC   PPDB Motif  PLACE Motif 
 OsREG616     GCCGGGCC  PPDB Motif  PLACE Motif 
 OsREG544      CCGGGCCG PPDB Motif  PLACE Motif 
REGGGTCCACG-2594225925942266-1106-1113
 OsREG570GGTCCACG PPDB Motif  PLACE Motif 
REGGGCCGTGG-2594228825942295-1135-1142
 OsREG521GGCCGTGG PPDB Motif  PLACE Motif 
REGTGCGGGCCCCACTGAC-2594229725942312-1144-1159
 OsREG632TGCGGGCC         PPDB Motif  PLACE Motif 
 OsREG619 GCGGGCCC        PPDB MotifGCCCA  PLACE Motif 
 OsREG567  CGGGCCCC       PPDB MotifACGGGC  PLACE Motif 
 OsREG641   GGGCCCCA      PPDB MotifGCCCA  PLACE Motif 
 OsREG631    GGCCCCAC     PPDB Motif  PLACE Motif 
 OsREG522        CCACTGAC PPDB Motif  PLACE MotifTGAC 
REGCCCACCCG-2594235425942361-1201-1208
 OsREG528CCCACCCG PPDB MotifGCCCA  PLACE Motif 
REGGACGTGGCG-2594241125942419-1258-1266
 OsREG585GACGTGGC  PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG448 ACGTGGCG PPDB MotifACGT  PLACE MotifACGTGKC 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.