version
PlantPromoterDB promoter information of 004-018-B01

Summary of Gene (004-018-B01)

Organism Oryza sativa  
Chromosome 1  
Locus Os01g0283100        NCBI 
Gene model 004-018-B01  
Description NONE  
#
#

Overview

Focused view (chromosome 1: 10166347-10167546)

Genome position     
from initiation codon
006-072-E12         
AK060908            
AK071713            
AK104205            
AK122051            
J013093G24          
J023109L19          
J033107E05          
J090016N03          
J090034K20          
J100031C14          
J100033O10          
TSS from cDNA
TSS information
004-018-B01                      5'->3' (+)
Promoter sequence
















 
AK073165            
J033023G08          
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence








 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of 004-018-B01

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone+10167250-97

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCCCTCCTCCTCTCCTCTCCTCTCC+1016721810167242-129-105
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGTGTGGGCTTC+1016699910167008-348-339
 OsREG461TGTGGGCT   PPDB MotifGCCCA  PLACE Motif 
 OsREG427 GTGGGCTT  PPDB MotifGCCCA  PLACE Motif 
 OsREG582  TGGGCTTC PPDB MotifGCCCA  PLACE Motif 
REGAGTGGGCCTC+1016702110167030-326-317
 OsREG478AGTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG472 GTGGGCCT  PPDB MotifGCCCA  PLACE Motif 
 OsREG587  TGGGCCTC PPDB MotifGCCCA  PLACE Motif 
REGAGATGGGCCTA+1016703510167045-312-302
 OsREG456AGATGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG590 GATGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG474  ATGGGCCT  PPDB MotifGCCCA  PLACE Motif 
 OsREG656   TGGGCCTA PPDB MotifGCCCA  PLACE Motif 
REGCTGGCCCATAC+1016705010167060-297-287
 OsREG577CTGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG488 TGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG630  GGCCCATA  PPDB MotifGCCCA  PLACE Motif 
 OsREG606   GCCCATAC PPDB MotifGCCCA  PLACE Motif 
REGTGCGGGCCGGG+1016706610167076-281-271
 OsREG632TGCGGGCC    PPDB Motif  PLACE Motif 
 OsREG538   GGGCCGGG PPDB MotifGCCCA  PLACE Motif 
REGACTGGGCCGCAAATGGGCCAG+1016708310167103-264-244
 OsREG454ACTGGGCC              PPDB MotifGCCCA  PLACE Motif 
 OsREG565 CTGGGCCG             PPDB MotifGCCCA  PLACE Motif 
 OsREG618  TGGGCCGC            PPDB MotifGCCCA  PLACE Motif 
 OsREG643   GGGCCGCA           PPDB MotifGCCCA  PLACE Motif 
 OsREG422          AAATGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG431           AATGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG488            ATGGGCCA  PPDB MotifGCCCA  PLACE Motif 
 OsREG577             TGGGCCAG PPDB MotifGCCCA  PLACE Motif 
REGAGAGTGGG+1016711710167124-230-223
 OsREG455AGAGTGGG PPDB Motif  PLACE Motif 
REGCCCACTCC+1016718310167190-164-157
 OsREG532CCCACTCC PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS clone peakTclone-10166978AK073165, AK073165, J033023G08
TSS clone peakAclone-10166954AK073165, AK073165, J033023G08

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTCTCCTCC-1016693210166940AK073165, J033023G08
Y PatchTCTCTCTCC-1016697910166987AK073165, J033023G08
Y PatchTCTCCTCCCT-1016698910166998AK073165, J033023G08
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGGAAGCCCACA-1016699910167008AK073165, J033023G08
 OsREG582GAAGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG427 AAGCCCAC  PPDB MotifGCCCA  PLACE Motif 
 OsREG461  AGCCCACA PPDB MotifGCCCA  PLACE Motif 
REGGAGGCCCACT-1016702110167030AK073165, J033023G08
 OsREG587GAGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG472 AGGCCCAC  PPDB MotifGCCCA  PLACE Motif 
 OsREG478  GGCCCACT PPDB MotifGCCCA  PLACE Motif 
REGTAGGCCCATCT-1016703510167045AK073165, J033023G08
 OsREG656TAGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG474 AGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG590  GGCCCATC  PPDB MotifGCCCA  PLACE Motif 
 OsREG456   GCCCATCT PPDB MotifGCCCA  PLACE Motif 
REGGTATGGGCCAG-1016705010167060AK073165, J033023G08
 OsREG606GTATGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG630 TATGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG488  ATGGGCCA  PPDB MotifGCCCA  PLACE Motif 
 OsREG577   TGGGCCAG PPDB MotifGCCCA  PLACE Motif 
REGCCCGGCCCGCA-1016706610167076AK073165, J033023G08
 OsREG538CCCGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG632   GGCCCGCA PPDB Motif  PLACE Motif 
REGCTGGCCCATTTGCGGCCCAGT-1016708310167103AK073165, J033023G08
 OsREG577CTGGCCCA              PPDB MotifGCCCA  PLACE Motif 
 OsREG488 TGGCCCAT             PPDB MotifGCCCA  PLACE Motif 
 OsREG431  GGCCCATT            PPDB MotifGCCCA  PLACE Motif 
 OsREG422   GCCCATTT           PPDB MotifGCCCA  PLACE Motif 
 OsREG643          TGCGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG618           GCGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG565            CGGCCCAG  PPDB MotifGCCCA  PLACE Motif 
 OsREG454             GGCCCAGT PPDB MotifGCCCA  PLACE Motif 
REGCCCACTCT-1016711710167124AK073165, J033023G08
 OsREG455CCCACTCT PPDB Motif  PLACE Motif 
REGGGAGTGGG-1016718310167190AK073165, J033023G08
 OsREG532GGAGTGGG PPDB MotifGCCCA  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.