version
PlantPromoterDB promoter information of 005-017-H08

Summary of Gene (005-017-H08)

Organism Oryza sativa  
Chromosome 7  
Locus Os07g0479200        NCBI 
Gene model 005-017-H08  
Description NONE  
#
#

Overview

Focused view (chromosome 7: 18063915-18065114)

Genome position     
from initiation codon
AK058326            
J013092A08          
J033139E04          
J043016M16          
J053050O18          
J053098B03          
J065041C24          
J065068G10          
J065091I17          
J065109A03          
J065168B17          
J065177A05          
J065180J01          
J075006F13          
J075022J03          
J075024N09          
J075114B12          
J080023M06          
J080081N24          
J090060N07          
TSS from cDNA
TSS information
005-017-H08                      5'->3' (+)
Promoter sequence











 
AK108177            
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of 005-017-H08

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+18064807-108

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCCTTCCTCCTCCTCCC+1806476218064778-153-137
Y PatchTCTCCTCCCTC+1806483118064841-84-74
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGAGGCCCAAA+1806466218064671-253-244
 OsREG587GAGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG471 AGGCCCAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG625  GGCCCAAA PPDB MotifGCCCA  PLACE Motif 
REGACAGCCCAAA+1806467818064687-237-228
 OsREG435ACAGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG511 CAGCCCAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG457  AGCCCAAA PPDB MotifGCCCA  PLACE Motif 
REGGAGGCCCACGC+1806470418064714-211-201
 OsREG587GAGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG472 AGGCCCAC   PPDB MotifGCCCA  PLACE Motif 
 OsREG571  GGCCCACG  PPDB MotifGCCCA  PLACE Motif 
 OsREG602   GCCCACGC PPDB MotifGCCCA  PLACE Motif 
REGGTTGGTGG+1806472318064730-192-185
 OsREG520GTTGGTGG PPDB MotifCCAACGG  PLACE Motif 
REGTTCGGCCCAACACGTCAC+1806473218064749-183-166
 OsREG642TTCGGCCC           PPDB MotifGCCCA  PLACE Motif 
 OsREG658 TCGGCCCA          PPDB MotifGCCCA  PLACE Motif 
 OsREG563  CGGCCCAA         PPDB MotifGCCCA  PLACE Motif 
 OsREG626   GGCCCAAC        PPDB MotifGCCCA, CCAACGG  PLACE Motif 
 OsREG594    GCCCAACA       PPDB MotifGCCCA  PLACE Motif 
 OsREG505          CACGTCAC PPDB MotifACGT  PLACE MotifTGAC 
REGATCTGGGCTTT+1806475218064762-163-153
 OsREG486ATCTGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG428  CTGGGCTT  PPDB MotifGCCCA  PLACE Motif 
 OsREG421   TGGGCTTT PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.