version
PlantPromoterDB promoter information of 006-027-E12

Summary of Gene (006-027-E12)

Organism Oryza sativa  
Chromosome 8  
Locus Os08g0139100        NCBI 
Gene model 006-027-E12  
Description NONE  
#
#

Overview

Focused view (chromosome 8: 2179254-2178055)

Genome position     
from initiation codon
006-089-E06         
006-113-G02         
AK061429            
AK099590            
AK104727            
J013043H11          
J013049N13          
J065079F01          
J065122N24          
J065142J24          
J065193N03          
J075041I21          
J075145E04          
TSS from cDNA
TSS information
006-027-E12                      5'->3' (-)
Promoter sequence



 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of 006-027-E12

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-2179182-928
TSS clone peakGclone-2179176-922

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCTCCTCCC-21791392179147-885-893
Y PatchCTCCCTCTCCCC-21791572179168-903-914
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGGCCCGGCCCGGCCCGGCCCACT-21792652179287-1011-1033
 OsREG616GGCCCGGCCCGGCCCGGC      PPDB Motif  PLACE Motif 
 OsREG614 GCCCGGCCCGGCCCGGCC     PPDB Motif  PLACE Motif 
 OsREG538  CCCGGCCCGGCCCGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG544    CGGCCCGGCCCGG       PPDB Motif  PLACE Motif 
 OsREG542             CCGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG564              CGGCCCAC  PPDB MotifGCCCA  PLACE Motif 
 OsREG478               GGCCCACT PPDB MotifGCCCA  PLACE Motif 
REGTCCACGCC-21792942179301-1040-1047
 OsREG636TCCACGCC PPDB Motif  PLACE Motif 
REGACAGCCCATAA-21793032179313-1049-1059
 OsREG435ACAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG491 CAGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG465  AGCCCATA  PPDB MotifGCCCA  PLACE Motif 
 OsREG605   GCCCATAA PPDB MotifGCCCA  PLACE Motif 
REGAGCCCACAC-21793172179325-1063-1071
 OsREG461AGCCCACA  PPDB MotifGCCCA  PLACE Motif 
 OsREG598 GCCCACAC PPDB MotifGCCCA  PLACE Motif 
REGTAAGCCCATCT-21793272179337-1073-1083
 OsREG655TAAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG429 AAGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG466  AGCCCATC  PPDB MotifGCCCA  PLACE Motif 
 OsREG456   GCCCATCT PPDB MotifGCCCA  PLACE Motif 
REGAATTGGGCCTC-21793402179350-1086-1096
 OsREG433AATTGGGC    PPDB MotifGCCCA  PLACE Motif 
 OsREG492 ATTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG471  TTGGGCCT  PPDB MotifGCCCA  PLACE Motif 
 OsREG587   TGGGCCTC PPDB MotifGCCCA  PLACE Motif 
REGTGAGGGAC-21793692179376-1115-1122
 OsREG652TGAGGGAC PPDB MotifGGGACCC  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.