PlantPromoterDB promoter information of 006-028-A09
Summary of Gene (006-028-A09)
|
Overview
|
Focused view (chromosome 3: 4351983-4350784)
|
Genome position
from initiation codon 003-113-H10 003-118-G01 006-047-D01 006-052-D04 006-087-H06 006-089-B03 006-092-D08 006-093-E07 009-029-H07 009-067-B05 009-091-F04 009-101-C10 009-113-A06 009-140-E12 009-145-E10 009-196-F02 011-054-E07 012-074-E10 012-076-E11 014-006-C07 014-085-G11 015-049-C04 015-062-E10 016-063-E02 AK058349 AK105922 AK106163 AK119553 AY831395 TSS from cDNA TSS information 006-028-A09 5'->3' (-) Promoter sequence TSS from cDNA TSS information 3'->5' (+) Promoter sequence |
|
|
|
Promoter Summary of 006-028-A09
TSS information
| Type | Sequence | TPM score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Position from initiation codon | |
| Strand | Position | Position | |||
| TSS clone peak | A | clone | - | 4351794 | -61 |
Core promoter information
| Type | Sequence | Genome position | Position from initiation codon | |||
| Strand | Start | End | Start | End | ||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | None | None | None | |||
| Y Patch | CTCTCTCCTTCCTC | - | 4351795 | 4351808 | -62 | -75 |
| Y Patch | CCCCCCTCCCCC | - | 4351830 | 4351841 | -97 | -108 |
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Position from initiation codon | |||||
| Strand | Start | End | Start | End | |||||
| REG | CCCCCGCGTGGGCCCCACCCACCTG | - | 4351933 | 4351957 | -200 | -224 | |||
| OsREG537 | CCCCCGCG | PPDB Motif | PLACE Motif | ||||||
| OsREG530 | CGCGTGGG | PPDB Motif | GCCCA | PLACE Motif | |||||
| OsREG602 | GCGTGGGC | PPDB Motif | GCCCA | PLACE Motif | |||||
| OsREG571 | CGTGGGCC | PPDB Motif | GCCCA | PLACE Motif | |||||
| OsREG640 | GTGGGCCC | PPDB Motif | GCCCA | PLACE Motif | |||||
| OsREG647 | TGGGCCCC | PPDB Motif | GCCCA | PLACE Motif | |||||
| OsREG641 | GGGCCCCA | PPDB Motif | GCCCA | PLACE Motif | |||||
| OsREG631 | GGCCCCAC | PPDB Motif | PLACE Motif | ||||||
| OsREG612 | GCCCCACC | PPDB Motif | PLACE Motif | ||||||
| OsREG514 | CCCACCTG | PPDB Motif | GCCCA | PLACE Motif | |||||
| REG | CAAGTGGG | - | 4352000 | 4352007 | -267 | -274 | |||
| OsREG498 | CAAGTGGG | PPDB Motif | GCCCA | PLACE Motif | |||||
| REG | CACGGCCCG | - | 4352028 | 4352036 | -295 | -303 | |||
| OsREG504 | CACGGCCC | PPDB Motif | GCCCA | PLACE Motif | |||||
| OsREG446 | ACGGCCCG | PPDB Motif | ACGGGC | PLACE Motif | |||||
Other Reliable Promoter Summary
TSS information
| Type | Sequence | TPM score | Genome position | Gene model | |
| Strand | Position | ||||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
TSS information from cDNA
| Type | Sequence | Score | Genome position | Gene model | |
| Strand | Position | ||||
| Not Available | Not Available | Not Available | Not Available | Not Available | |
Core promoter information
| Type | Sequence | Genome position | Gene model | |||
| Strand | Start | End | ||||
| initiator | Not Available | Not Available | Not Available | |||
| TATA Box | None | None | None | |||
| Y Patch | None | None | None | |||
| GA | None | None | None | |||
| Inr | None | None | None | |||
REG information
| Type | Sequence | Annotation | Genome position | Gene model | |||||
| Strand | Start | End | |||||||
| REG | None | None | None | ||||||