version
PlantPromoterDB promoter information of 006-045-A10

Summary of Gene (006-045-A10)

Organism Oryza sativa  
Chromosome 1  
Locus Os01g0764000        NCBI 
Gene model 006-045-A10  
Description NONE  
#
#

Overview

Focused view (chromosome 1: 33908698-33907499)

Genome position     
from initiation codon
006-021-G03         
006-025-C07         
006-029-G11         
006-030-C04         
006-035-E05         
006-037-G01         
006-038-C01         
006-039-G05         
006-042-E11         
006-044-H04         
006-045-C05         
006-047-A11         
006-048-H10         
006-050-C01         
006-050-H11         
006-051-G10         
006-051-G11         
006-056-B04         
006-063-F04         
006-063-H12         
006-065-G09         
006-067-F11         
006-073-D10         
006-074-G09         
006-075-D04         
006-077-C10         
006-082-A10         
006-084-C12         
006-085-F05         
006-087-H12         
006-092-E10         
006-094-C06         
006-096-G11         
006-097-H11         
006-101-A07         
006-101-G08         
006-110-E08         
006-111-D04         
006-116-H04         
AK058894            
AK059818            
AK099142            
J013119N15          
J013123P15          
J023055F24          
J023125K17          
J053050A20          
J053056P10          
J053074D19          
J053078A14          
J053086P10          
J053094N23          
J053095M23          
J065006D02          
J065030A17          
J065030K04          
J065035L12          
J065046E12          
J065065H19          
J065073C01          
J065105F01          
J065131N16          
J065144O13          
J065160E12          
J065160K02          
J065163F09          
J065165E18          
J065174E04          
J065175O08          
J065191N24          
J065193D19          
J065198D04          
J065200G09          
J075016L06          
J075017J11          
J075019L08          
J075028M08          
J075029K05          
J075039K04          
J075047J22          
J075079H13          
J075095K14          
J075111D21          
J075131A19          
J075147G20          
J075158F11          
J075166N10          
J075196G09          
J075198I24          
J090001L08          
J090026G07          
J090050M15          
J090071A01          
J090072P16          
J090078D22          
J090089C18          
J100019B07          
J100019H15          
J100019P09          
J100023A16          
J100023B09          
J100026O18          
J100027E09          
J100028F22          
J100029P05          
J100031M19          
J100032A11          
J100036G19          
J100038E22          
J100040A12          
J100040L02          
J100043O13          
J100045E20          
J100046H18          
J100047E08          
J100050E08          
J100050P14          
J100051G10          
J100052L12          
J100056G24          
J100066B15          
J100068O15          
J100070J16          
J100074I22          
J100075M12          
J100077M09          
J100077O14          
J100079J08          
J100080I16          
TSS from cDNA
TSS information
006-045-A10                      5'->3' (-)
Promoter sequence






 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of 006-045-A10

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-33907880-182
TSS clone peakGclone-33907773-75

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTTCCTCCTCC-3390776133907771-63-73
Y PatchCCCTTCTC-3390777433907781-76-83
Y PatchCTCCTCCT-3390788933907896-191-198
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCGATCCG-3390782733907834-129-136
 OsREG541CCGATCCG PPDB Motif  PLACE Motif 
REGACCCGCGCGAG-3390785433907864-156-166
 OsREG439ACCCGCGC    PPDB Motif  PLACE Motif 
 OsREG558   CGCGCGAG PPDB MotifACGCGC  PLACE Motif 
REGCACCGCAC-3390787733907884-179-186
 OsREG500CACCGCAC PPDB Motif  PLACE Motif 
REGGACGGCCCACCCACCAAC-3390792033907937-222-239
 OsREG584GACGGCCC           PPDB MotifGCCCA  PLACE Motif 
 OsREG445 ACGGCCCA          PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG564  CGGCCCAC         PPDB MotifGCCCA  PLACE Motif 
 OsREG628   GGCCCACC        PPDB MotifGCCCA  PLACE Motif 
 OsREG600    GCCCACCC       PPDB MotifGCCCA  PLACE Motif 
 OsREG520          CCACCAAC PPDB MotifCCAACGG  PLACE Motif 
REGGGCCCCACAC-3390806233908071-364-373
 OsREG631GGCCCCAC   PPDB Motif  PLACE Motif 
 OsREG611 GCCCCACA  PPDB Motif  PLACE Motif 
 OsREG535  CCCCACAC PPDB Motif  PLACE Motif 
REGGGTCCCAC-3390807633908083-378-385
 OsREG650GGTCCCAC PPDB MotifGGGACCC  PLACE Motif 
REGGTCCCACC-3390814833908155-450-457
 OsREG651GTCCCACC PPDB MotifGGGACCC  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.