version
PlantPromoterDB promoter information of 006-045-E10

Summary of Gene (006-045-E10)

Organism Oryza sativa  
Chromosome 9  
Locus Os09g0565200        NCBI 
Gene model 006-045-E10  
Description NONE  
#
#

Overview

Focused view (chromosome 9: 23339195-23337996)

Genome position     
from initiation codon
004-007-A08         
006-051-A01         
006-079-G03         
006-097-C05         
006-097-E11         
006-111-E07         
AK069121            
AK104354            
J013090J23          
J013093C19          
J023007A14          
J023099J21          
J065023L09          
J075060J06          
J075092C03          
TSS from cDNA
TSS information
006-045-E10                      5'->3' (-)
Promoter sequence


 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of 006-045-E10

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-23339166-971

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCTCCTCC-2333912923339136-934-941
Y PatchCCCCTTCCT-2333916923339177-974-982
Y PatchCCTTCTCCTCCCCC-2333919723339210-1002-1015
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGATATGGGCCGTGATTTGGGCCCATGG-2333927723339302-1082-1107
 OsREG480ATATGGGC                   PPDB MotifGCCCA  PLACE Motif 
 OsREG630 TATGGGCC                  PPDB MotifGCCCA  PLACE Motif 
 OsREG490  ATGGGCCG                 PPDB MotifGCCCA  PLACE Motif 
 OsREG445   TGGGCCGT                PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG504    GGGCCGTG               PPDB MotifGCCCA  PLACE Motif 
 OsREG493            ATTTGGGC       PPDB MotifGCCCA  PLACE Motif 
 OsREG625             TTTGGGCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG639              TTGGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG489                GGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
 OsREG517                 GGCCCATG  PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG525                  GCCCATGG PPDB MotifGCCCA, CCATGG  PLACE Motif 
REGTACGGCCCAGAT-2333932123339332-1126-1137
 OsREG645TACGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG445 ACGGCCCA    PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG565  CGGCCCAG   PPDB MotifGCCCA  PLACE Motif 
 OsREG629   GGCCCAGA  PPDB MotifGCCCA  PLACE Motif 
 OsREG486    GCCCAGAT PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.