version
PlantPromoterDB promoter information of 006-056-H12

Summary of Gene (006-056-H12)

Organism Oryza sativa  
Chromosome 7  
Locus Os07g0141400        NCBI 
Gene model 006-056-H12  
Description NONE  
#
#

Overview

Focused view (chromosome 7: 2171381-2170182)

Genome position     
from initiation codon
003-129-D08         
006-021-E02         
006-025-C06         
006-027-H11         
006-036-C05         
006-046-D07         
006-047-A02         
006-050-F02         
006-053-D07         
006-054-E06         
006-055-E01         
006-055-F01         
006-057-D07         
006-074-G10         
006-077-C02         
006-081-E01         
006-089-B08         
006-089-C10         
006-092-E07         
006-096-C11         
006-096-H06         
006-097-E07         
006-098-D03         
006-102-C05         
006-107-E09         
006-110-C09         
006-113-C01         
006-114-D09         
006-115-H06         
009-016-G06         
009-031-C05         
009-060-B05         
009-123-H12         
009-154-B09         
009-172-F07         
009-193-A04         
AF022732            
AF052203            
AK065248            
AK104722            
D49713              
J013002J02          
J065051O13          
J065066J18          
J065077G23          
J065162C22          
J065162G22          
J075091B13          
J075099J22          
J100079F20          
TSS from cDNA
TSS information
006-056-H12                      5'->3' (-)
Promoter sequence






 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of 006-056-H12

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-2170446-65

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGCCCCCAC-21705052170512-124-131
 OsREG613GCCCCCAC PPDB Motif  PLACE Motif 
REGGATCCGACGTGGGCCAA-21705952170611-214-230
 OsREG588GATCCGAC          PPDB MotifCCGAC  PLACE Motif 
 OsREG483 ATCCGACG         PPDB MotifCCGAC  PLACE MotifCGACG 
 OsREG449      ACGTGGGC    PPDB MotifGCCCA, ACGT  PLACE MotifACGTSSSC 
 OsREG571       CGTGGGCC   PPDB MotifGCCCA  PLACE Motif 
 OsREG654        GTGGGCCA  PPDB MotifGCCCA  PLACE Motif 
 OsREG660         TGGGCCAA PPDB MotifGCCCA  PLACE Motif 
REGGCGCGCGAC-21706242170632-243-251
 OsREG617GCGCGCGA  PPDB Motif  PLACE Motif 
 OsREG557 CGCGCGAC PPDB MotifACGCGC  PLACE Motif 
REGGTGACGTG-21706412170648-260-267
 OsREG505GTGACGTG PPDB MotifACGT  PLACE MotifTGAC 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.