version
PlantPromoterDB promoter information of 006-057-H04

Summary of Gene (006-057-H04)

Organism Oryza sativa  
Chromosome 1  
Locus Os01g0805800        NCBI 
Gene model 006-057-H04  
Description NONE  
#
#

Overview

Focused view (chromosome 1: 35923112-35921913)

Genome position     
from initiation codon
006-106-H01         
AK059963            
AK103408            
J033103I19          
J033128E13          
J090035G24          
TSS from cDNA
TSS information
006-057-H04                      5'->3' (-)
Promoter sequence







 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of 006-057-H04

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakGclone-35922229-117
TSS clone peakAclone-35922188-76

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchTCCCCCTCCCCTCTC-3592220735922221-95-109
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGGGGCCCACGCGTCATCCACC-3592228835922308-176-196
 OsREG647GGGGCCCA              PPDB MotifGCCCA  PLACE Motif 
 OsREG640 GGGCCCAC             PPDB MotifGCCCA  PLACE Motif 
 OsREG571  GGCCCACG            PPDB MotifGCCCA  PLACE Motif 
 OsREG602   GCCCACGC           PPDB MotifGCCCA  PLACE Motif 
 OsREG530    CCCACGCG          PPDB MotifGCCCA  PLACE Motif 
 OsREG443     CCACGCGT         PPDB Motif  PLACE Motif 
 OsREG515             CATCCACC PPDB Motif  PLACE Motif 
REGCAAGGCCCAAT-3592234835922358-236-246
 OsREG497CAAGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG430 AAGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG471  AGGCCCAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG492   GGCCCAAT PPDB MotifGCCCA  PLACE Motif 
REGGCCGGCCCAAG-3592236935922379-257-267
 OsREG615GCCGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG542 CCGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG563  CGGCCCAA  PPDB MotifGCCCA  PLACE Motif 
 OsREG581   GGCCCAAG PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.