version
PlantPromoterDB promoter information of 006-067-C03

Summary of Gene (006-067-C03)

Organism Oryza sativa  
Chromosome 5  
Locus Os05g0413200        NCBI 
Gene model 006-067-C03  
Description NONE  
#
#

Overview

Focused view (chromosome 5: 20210482-20211681)

Genome position     
from initiation codon
006-080-C03         
006-095-G10         
006-115-G11         
013-040-E05         
AB104732            
AK122099            
J033087H20          
J033117C18          
J033125G10          
TSS from cDNA
TSS information
006-067-C03                      5'->3' (+)
Promoter sequence








 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of 006-067-C03

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+20210948-534

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxCGCTATAAAAA+2021090420210914-578-568
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCCCCGCG+2021073420210741-748-741
 OsREG537CCCCCGCG PPDB Motif  PLACE Motif 
REGAACGGGCC+2021077820210785-704-697
 OsREG424AACGGGCC PPDB MotifAAACG(C/G), ACGGGC, CCAACGG  PLACE Motif 
REGCGCGTGGGACCGTCCGATC+2021079820210816-684-666
 OsREG530CGCGTGGG            PPDB MotifGCCCA  PLACE Motif 
 OsREG650   GTGGGACC         PPDB MotifGGGACCC  PLACE Motif 
 OsREG545         CCGTCCGA   PPDB Motif  PLACE Motif 
 OsREG484          CGTCCGAT  PPDB Motif  PLACE Motif 
 OsREG589           GTCCGATC PPDB Motif  PLACE Motif 
REGCCCATCCAACGGCC+2021081820210831-664-651
 OsREG534CCCATCCA       PPDB MotifGCCCA  PLACE Motif 
 OsREG481   ATCCAACG    PPDB MotifCCAACGG  PLACE Motif 
 OsREG548    TCCAACGG   PPDB MotifCCAACGG  PLACE Motif 
 OsREG518     CCAACGGC  PPDB MotifCCAACGG  PLACE Motif 
 OsREG494      CAACGGCC PPDB MotifCCAACGG  PLACE Motif 
REGGCCGTCCGATCCG+2021087220210884-610-598
 OsREG562GCCGTCCG      PPDB Motif  PLACE Motif 
 OsREG545 CCGTCCGA     PPDB Motif  PLACE Motif 
 OsREG484  CGTCCGAT    PPDB Motif  PLACE Motif 
 OsREG589   GTCCGATC   PPDB Motif  PLACE Motif 
 OsREG541     CCGATCCG PPDB Motif  PLACE Motif 
REGGCCCCACG+2021089320210900-589-582
 OsREG572GCCCCACG PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.