version
PlantPromoterDB promoter information of 006-074-A02

Summary of Gene (006-074-A02)

Organism Oryza sativa  
Chromosome 2  
Locus Os02g0666200        NCBI 
Gene model 006-074-A02  
Description NONE  
#
#

Overview

Focused view (chromosome 2: 27931113-27932312)

Genome position     
from initiation codon
006-021-D11         
006-022-F02         
006-022-H11         
006-024-C03         
006-026-G05         
006-027-F11         
006-028-G06         
006-028-H05         
006-030-H06         
006-030-H12         
006-031-C07         
006-031-G01         
006-033-F09         
006-035-A01         
006-035-A12         
006-035-F04         
006-036-G09         
006-038-A01         
006-038-A03         
006-039-D08         
006-042-C11         
006-042-H06         
006-044-E01         
006-045-E05         
006-046-G05         
006-047-A03         
006-048-H08         
006-052-A07         
006-053-A05         
006-054-G06         
006-056-D10         
006-057-B07         
006-058-F12         
006-060-D01         
006-061-A12         
006-062-E02         
006-063-F11         
006-063-H02         
006-066-F12         
006-067-H12         
006-068-B09         
006-068-D08         
006-071-A12         
006-072-H06         
006-074-F10         
006-077-H10         
006-078-G02         
006-081-B03         
006-084-H01         
006-084-H02         
006-084-H04         
006-087-H08         
006-090-B08         
006-091-E10         
006-093-G02         
006-094-B12         
006-094-E03         
006-095-G07         
006-095-H07         
006-097-G08         
006-098-E12         
006-099-A04         
006-099-E08         
006-103-B12         
006-103-F12         
006-104-G02         
006-105-F02         
006-107-D12         
006-108-F10         
006-108-H05         
006-110-G11         
006-111-D10         
006-111-E03         
006-111-H01         
006-113-C12         
006-114-C10         
006-115-B02         
006-117-D11         
006-117-E01         
009-131-C02         
009-133-G05         
009-152-E01         
009-154-E08         
009-196-C11         
012-010-E10         
013-018-C05         
013-074-A06         
013-078-E06         
AB009665            
AF022737            
AJ224327            
AK061769            
AK103807            
AK104658            
J013065I12          
J013067L09          
J013089I10          
J013095N22          
J013130E17          
J013131A06          
J013154E06          
J023004D16          
J023010A15          
J023010H04          
J023049K10          
J023056H24          
J023064J12          
J023078I06          
J023081D05          
J023099I19          
J023100F05          
J023131F16          
J033025F16          
J033028F10          
J033058H13          
J033064P18          
J033070H04          
J033107P20          
J033114E09          
J033125G23          
J033136G05          
J033147A07          
J053048M24          
J053056K02          
J053057N24          
J053060C13          
J065053C22          
J065067J11          
J065085A01          
J065189K01          
J075024G24          
J075060O04          
J075075M07          
J075090A10          
J075110P11          
J075114H02          
J075127L13          
J075151B19          
J075187M17          
J075198E22          
J080006J20          
J080081J10          
J080087C03          
J090029E22          
J090037C19          
J090037P10          
J090047M10          
J090055K05          
J090057N19          
J090062M13          
J090066F22          
J090066N12          
J090071K08          
J090080F16          
J090081J21          
J090083F22          
J090083I12          
J090088B16          
J090088E01          
J090091C11          
J090091F17          
J090097A05          
J090098B15          
J100018B04          
J100021J08          
J100026M12          
J100032F02          
J100034B03          
J100037D13          
J100041C16          
J100044D14          
J100044E21          
J100047M16          
J100051D22          
J100056M13          
J100061J12          
J100065A22          
J100067L12          
J100068F06          
J100070C24          
J100072N09          
J100073A10          
J100073B15          
J100077F05          
J100078B03          
J100078F01          
J100079B08          
J100083J06          
TSS from cDNA
TSS information
006-074-A02                      5'->3' (+)
Promoter sequence








 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of 006-074-A02

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+27931256-57

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxCCTTTATA+2793122227931229-91-84
Y PatchCTCCTCTCTCTC+2793123827931249-75-64
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCTGGCCCACCAGGGCCCACGC+2793111927931139-194-174
 OsREG577CTGGCCCA              PPDB MotifGCCCA  PLACE Motif 
 OsREG654 TGGCCCAC             PPDB MotifGCCCA  PLACE Motif 
 OsREG628  GGCCCACC            PPDB MotifGCCCA  PLACE Motif 
 OsREG599   GCCCACCA           PPDB MotifGCCCA  PLACE Motif 
 OsREG475          AGGGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG640           GGGCCCAC   PPDB MotifGCCCA  PLACE Motif 
 OsREG571            GGCCCACG  PPDB MotifGCCCA  PLACE Motif 
 OsREG602             GCCCACGC PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.