version
PlantPromoterDB promoter information of 006-075-B02

Summary of Gene (006-075-B02)

Organism Oryza sativa  
Chromosome 5  
Locus Os05g0155100        NCBI 
Gene model 006-075-B02  
Description NONE  
#
#

Overview

Focused view (chromosome 5: 3207421-3208620)

Genome position     
from initiation codon
AK061929            
AK102810            
AK120877            
J013023E03          
J013038C16          
J013120M14          
J013159B07          
J023012A02          
J023027F08          
J023027I12          
J023120F05          
J023138O03          
J023142H13          
J023143P06          
J033023P09          
J033035O14          
J033042N19          
J033043B12          
J033065D10          
J033081A12          
J033084N05          
J033085M03          
J033112D15          
J033114O07          
J033119D15          
J033140E06          
J033141K23          
J043040I22          
J053050B21          
J053065I18          
J053074O16          
J065072K13          
J065211I09          
J090004K04          
J090016L06          
J090040F22          
J090063F22          
J100032A10          
J100037G20          
J100056O10          
J100071D10          
J100075K13          
J100079F16          
J100080O16          
J100086N05          
TSS from cDNA
TSS information
006-075-B02                      5'->3' (+)
Promoter sequence











 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of 006-075-B02

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone+3208358-63

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxTCTATATAG+32083143208322-107-99
Y PatchTCTCCTCT+32083093208316-112-105
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCGACCCGC+32080603208067-361-354
 OsREG552CGACCCGC PPDB Motif  PLACE Motif 
REGCCGTGGGCCGGA+32080873208098-334-323
 OsREG547CCGTGGGC     PPDB MotifGCCCA  PLACE Motif 
 OsREG571 CGTGGGCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG564  GTGGGCCG   PPDB MotifGCCCA  PLACE Motif 
 OsREG542   TGGGCCGG  PPDB MotifGCCCA  PLACE Motif 
 OsREG644    GGGCCGGA PPDB MotifGCCCA  PLACE Motif 
REGCGCACCGC+32081033208110-318-311
 OsREG554CGCACCGC PPDB Motif  PLACE Motif 
REGTCAGCCCATG+32081923208201-229-220
 OsREG657TCAGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG491 CAGCCCAT  PPDB MotifGCCCA  PLACE Motif 
 OsREG467  AGCCCATG PPDB MotifGCCCA, CCATGG  PLACE Motif 
REGAAGGCCCAAACCAGCCCACAA+32082143208234-207-187
 OsREG430AAGGCCCA              PPDB MotifGCCCA  PLACE Motif 
 OsREG471 AGGCCCAA             PPDB MotifGCCCA  PLACE Motif 
 OsREG625  GGCCCAAA            PPDB MotifGCCCA  PLACE Motif 
 OsREG593   GCCCAAAC           PPDB MotifGCCCA  PLACE Motif 
 OsREG523          CCAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG461            AGCCCACA  PPDB MotifGCCCA  PLACE Motif 
 OsREG597             GCCCACAA PPDB MotifGCCCA  PLACE Motif 
REGCCCACCACTCCGGCCCACGAGGCCCACCAC+32082493208278-172-143
 OsREG527CCCACCAC              CCCACCAC PPDB MotifGCCCA  PLACE Motif 
 OsREG644        TCCGGCCC               PPDB MotifGCCCA  PLACE Motif 
 OsREG542         CCGGCCCA              PPDB MotifGCCCA  PLACE Motif 
 OsREG564          CGGCCCAC             PPDB MotifGCCCA  PLACE Motif 
 OsREG571           GGCCCACG            PPDB MotifGCCCA  PLACE Motif 
 OsREG601            GCCCACGA           PPDB MotifGCCCA  PLACE Motif 
 OsREG587                  GAGGCCCA     PPDB MotifGCCCA  PLACE Motif 
 OsREG472                   AGGCCCAC    PPDB MotifGCCCA  PLACE Motif 
 OsREG628                    GGCCCACC   PPDB MotifGCCCA  PLACE Motif 
 OsREG599                     GCCCACCA  PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.