version
PlantPromoterDB promoter information of 006-080-F07

Summary of Gene (006-080-F07)

Organism Oryza sativa  
Chromosome 8  
Locus Os08g0548900        NCBI 
Gene model 006-080-F07  
Description NONE  
#
#

Overview

Focused view (chromosome 8: 27620332-27621531)

Genome position     
from initiation codon
006-043-D07         
006-043-H11         
006-081-G06         
006-109-E04         
011-033-E04         
AK061808            
AK098875            
J013001D12          
J033126N14          
J053069M09          
J053098E10          
J053101C24          
J065002F21          
J065006C22          
J065076J02          
J065134M22          
J075007M19          
J075040I11          
J075047E20          
J075052D22          
J075076L13          
J075157P22          
J075161M18          
J075168P22          
J075181E04          
U92540              
TSS from cDNA
TSS information
006-080-F07                      5'->3' (+)
Promoter sequence









 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of 006-080-F07

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGNoneNoneNone

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS clone peakGclone+27621334AK061808, J075007M19, J075040I11, J075047E20, J075052D22, J075157P22, J075168P22, 011-033-E04, AK061808, 006-081-G06, J065006C22, J065134M22, J075076L13, AK098875, J013001D12, J033126N14, J075161M18, 006-043-H11, 006-109-E04, J065076J02, U92540, J065002F21, J075181E04, 006-043-D07, J053069M09, J053098E10, J053101C24
TSS clone peakAclone+27621355AK061808, J075007M19, J075040I11, J075047E20, J075052D22, J075157P22, J075168P22, 011-033-E04, AK061808, 006-081-G06, J065006C22, J065134M22, J075076L13, AK098875, J013001D12, J033126N14, J075161M18, 006-043-H11, 006-109-E04, J065076J02, U92540, J065002F21, J075181E04, 006-043-D07, J053069M09, J053098E10, J053101C24

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGCCATGGGCCCATGG+2762115927621172006-043-D07, 006-043-H11, 006-081-G06, 006-109-E04, 011-033-E04, AK061808, AK098875, J013001D12, J033126N14, J053069M09, J053098E10, J053101C24, J065002F21, J065006C22, J065076J02, J065134M22, J075007M19, J075040I11, J075047E20, J075052D22, J075076L13, J075157P22, J075161M18, J075168P22, J075181E04, U92540
 OsREG525CCATGGGCCCATGG PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG517 CATGGGCCCATG  PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG489  ATGGGCCCAT   PPDB MotifGCCCA  PLACE Motif 
REGCCATGGGCTTT+2762120727621217006-043-D07, 006-043-H11, 006-081-G06, 006-109-E04, 011-033-E04, AK061808, AK098875, J013001D12, J033126N14, J053069M09, J053098E10, J053101C24, J065002F21, J065006C22, J065076J02, J065134M22, J075007M19, J075040I11, J075047E20, J075052D22, J075076L13, J075157P22, J075161M18, J075168P22, J075181E04, U92540
 OsREG525CCATGGGC    PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG467 CATGGGCT   PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG429  ATGGGCTT  PPDB MotifGCCCA  PLACE Motif 
 OsREG421   TGGGCTTT PPDB MotifGCCCA  PLACE Motif 
REGGTGGGCTTC+2762123227621240006-043-D07, 006-043-H11, 006-081-G06, 006-109-E04, 011-033-E04, AK061808, AK098875, J013001D12, J033126N14, J053069M09, J053098E10, J053101C24, J065002F21, J065006C22, J065076J02, J065134M22, J075007M19, J075040I11, J075047E20, J075052D22, J075076L13, J075157P22, J075161M18, J075168P22, J075181E04, U92540
 OsREG427GTGGGCTT  PPDB MotifGCCCA  PLACE Motif 
 OsREG582 TGGGCTTC PPDB MotifGCCCA  PLACE Motif 
REGTCCGGCCCATGGGCCAA+2762126927621285006-043-D07, 006-043-H11, 006-081-G06, 006-109-E04, 011-033-E04, AK061808, AK098875, J013001D12, J033126N14, J053069M09, J053098E10, J053101C24, J065002F21, J065006C22, J065076J02, J065134M22, J075007M19, J075040I11, J075047E20, J075052D22, J075076L13, J075157P22, J075161M18, J075168P22, J075181E04, U92540
 OsREG644TCCGGCCC          PPDB MotifGCCCA  PLACE Motif 
 OsREG542 CCGGCCCA         PPDB MotifGCCCA  PLACE Motif 
 OsREG490  CGGCCCAT        PPDB MotifGCCCA  PLACE Motif 
 OsREG525    GCCCATGGGC    PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG517   GGCCCATGGGCC   PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG488        ATGGGCCA  PPDB MotifGCCCA  PLACE Motif 
 OsREG660         TGGGCCAA PPDB MotifGCCCA  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.