version
PlantPromoterDB promoter information of 006-081-C11

Summary of Gene (006-081-C11)

Organism Oryza sativa  
Chromosome 1  
Locus Os01g0150000        NCBI 
Gene model 006-081-C11  
Description NONE  
#
#

Overview

Focused view (chromosome 1: 2711336-2710137)

Genome position     
from initiation codon
006-053-H07         
009-050-D04         
AK060948            
AK066325            
J013062L06          
J023058M18          
J023112H22          
J053037H18          
J065048P05          
J100068N20          
J100073A02          
TSS from cDNA
TSS information
006-081-C11                      5'->3' (-)
Promoter sequence










 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of 006-081-C11

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-2710422-86

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCTCCTCC-27104412710448-105-112
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCCGTGGGCCCCACAC-27104762710491-140-155
 OsREG531CCCGTGGG         PPDB MotifGCCCA, ACGGGC  PLACE Motif 
 OsREG547 CCGTGGGC        PPDB MotifGCCCA  PLACE Motif 
 OsREG571  CGTGGGCC       PPDB MotifGCCCA  PLACE Motif 
 OsREG640   GTGGGCCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG647    TGGGCCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG641     GGGCCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG631      GGCCCCAC   PPDB Motif  PLACE Motif 
 OsREG611       GCCCCACA  PPDB Motif  PLACE Motif 
 OsREG535        CCCCACAC PPDB Motif  PLACE Motif 
REGGTGGGTCCAACGGCCCAGC-27104942710512-158-176
 OsREG622GTGGGTCC            PPDB MotifGGGACCC  PLACE Motif 
 OsREG548     TCCAACGG       PPDB MotifCCAACGG  PLACE Motif 
 OsREG518      CCAACGGC      PPDB MotifCCAACGG  PLACE Motif 
 OsREG494       CAACGGCC     PPDB MotifCCAACGG  PLACE Motif 
 OsREG423        AACGGCCC    PPDB MotifGCCCA, AAACG(C/G)  PLACE Motif 
 OsREG445         ACGGCCCA   PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG565          CGGCCCAG  PPDB MotifGCCCA  PLACE Motif 
 OsREG620           GGCCCAGC PPDB MotifGCCCA  PLACE Motif 
REGGGGCCGGA-27105302710537-194-201
 OsREG644GGGCCGGA PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.