version
PlantPromoterDB promoter information of 006-081-F03

Summary of Gene (006-081-F03)

Organism Oryza sativa  
Chromosome 7  
Locus Os07g0169600        NCBI 
Gene model 006-081-F03  
Description NONE  
#
#

Overview

Focused view (chromosome 7: 3731464-3732663)

Genome position     
from initiation codon
006-027-F04         
006-043-C10         
006-070-A04         
006-104-F02         
012-006-D12         
AK060318            
AK121818            
J023065K01          
J023086G17          
J023093G16          
J033024N04          
J033099A15          
J033107B14          
J043026F14          
J065043P20          
J075118L16          
J075162M22          
J080004K13          
J080024D10          
J080037C21          
J080039M17          
J080040A03          
J080044A07          
J080045I07          
J080052L06          
J080053A20          
J080060L15          
J080060N22          
J080062L23          
J080069B19          
J080086K15          
J080089H16          
J080089I23          
J080094P07          
J090032L18          
J100044E09          
J100045O03          
J100066B11          
J100069J24          
TSS from cDNA
TSS information
006-081-F03                      5'->3' (+)
Promoter sequence






 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of 006-081-F03

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakCclone+3731779-685
TSS clone peakAclone+3731782-682

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxTTATAAATT+37317473731755-717-709
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGGGGCCCACTTG+37315103731521-954-943
 OsREG647GGGGCCCA     PPDB MotifGCCCA  PLACE Motif 
 OsREG640 GGGCCCAC    PPDB MotifGCCCA  PLACE Motif 
 OsREG478  GGCCCACT   PPDB MotifGCCCA  PLACE Motif 
 OsREG498    CCCACTTG PPDB MotifGCCCA  PLACE Motif 
REGAGATGGGCCGTTG+37315743731586-890-878
 OsREG456AGATGGGC      PPDB MotifGCCCA  PLACE Motif 
 OsREG590 GATGGGCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG490  ATGGGCCG    PPDB MotifGCCCA  PLACE Motif 
 OsREG445   TGGGCCGT   PPDB MotifGCCCA  PLACE MotifAACAAAC 
 OsREG423    GGGCCGTT  PPDB MotifGCCCA, AAACG(C/G)  PLACE Motif 
 OsREG494     GGCCGTTG PPDB MotifCCAACGG  PLACE Motif 
REGACCGGCCC+37316073731614-857-850
 OsREG440ACCGGCCC PPDB MotifGCCCA, AACCG(G/A)  PLACE Motif 
REGTGTGGGGCCCACT+37316213731633-843-831
 OsREG611TGTGGGGC      PPDB Motif  PLACE Motif 
 OsREG631 GTGGGGCC     PPDB Motif  PLACE Motif 
 OsREG641  TGGGGCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG647   GGGGCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG640    GGGCCCAC  PPDB MotifGCCCA  PLACE Motif 
 OsREG478     GGCCCACT PPDB MotifGCCCA  PLACE Motif 
REGGCCACGTC+37316713731678-793-786
 OsREG585GCCACGTC PPDB MotifACGT  PLACE MotifACGTGKC 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.