version
PlantPromoterDB promoter information of 006-090-F11

Summary of Gene (006-090-F11)

Organism Oryza sativa  
Chromosome 4  
Locus Os04g0661900        NCBI 
Gene model 006-090-F11  
Description NONE  
#
#

Overview

Focused view (chromosome 4: 34175207-34176406)

Genome position     
from initiation codon
                    
AB037150            
AK061835            
AK103551            
AK104076            
J013093O22          
J013157M03          
J023014C08          
J023027D02          
J023042D23          
J023047F07          
J033025N04          
J033048F09          
J033103A21          
J033119A06          
J033132F12          
J033140J24          
J053071I02          
J053077D04          
J065139H14          
J065151N12          
J065162O03          
J065168J04          
J090067G20          
J090072N04          
J090086L10          
J090087A05          
J090095N01          
J100039F24          
J100079J06          
Os04g0661850        
TSS from cDNA
TSS information
006-090-F11                      5'->3' (+)
Promoter sequence









 
J043026N08          
J065015K02          
J065095F01          
J065171F06          
J065197N19          
J075014H22          
J075022C22          
J075025O06          
J075059J15          
J075106D08          
J075115L09          
J075118P19          
J075132A09          
J075143H07          
J075153C02          
J075161C08          
J075178F02          
J075187C13          
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of 006-090-F11

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone+34175994-213
TSS clone peakAclone+34176042-165
TSS cloneGclone+34176052-155
TSS cloneAclone+34176066-141

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGTTGGTGGTCATGGGCCAAAAAGCCCAACT+3417584334175872-364-335
 OsREG520GTTGGTGG                       PPDB MotifCCAACGG  PLACE Motif 
 OsREG609        TCATGGGC               PPDB MotifGCCCA  PLACE Motif 
 OsREG517         CATGGGCC              PPDB MotifGCCCA, CCATGG  PLACE Motif 
 OsREG488          ATGGGCCA             PPDB MotifGCCCA  PLACE Motif 
 OsREG660           TGGGCCAA            PPDB MotifGCCCA  PLACE Motif 
 OsREG419                  AAAAGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG421                   AAAGCCCA    PPDB MotifGCCCA  PLACE Motif 
 OsREG426                    AAGCCCAA   PPDB MotifGCCCA  PLACE Motif 
 OsREG458                     AGCCCAAC  PPDB MotifGCCCA, CCAACGG  PLACE Motif 
 OsREG479                      GCCCAACT PPDB MotifGCCCA  PLACE Motif 
REGTCTGGACC+3417589034175897-317-310
 OsREG649TCTGGACC PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.