version
PlantPromoterDB promoter information of 006-093-E07

Summary of Gene (006-093-E07)

Organism Oryza sativa  
Chromosome 3  
Locus Os03g0183300        NCBI 
Gene model 006-093-E07  
Description NONE  
#
#

Overview

Focused view (chromosome 3: 4352733-4351534)

Genome position     
from initiation codon
003-107-A07         
003-113-H10         
003-118-G01         
006-028-A09         
006-047-D01         
006-052-D04         
006-087-H06         
006-089-B03         
006-092-D08         
009-029-H07         
009-067-B05         
009-091-F04         
009-101-C10         
009-113-A06         
009-140-E12         
009-145-E10         
009-196-F02         
011-054-E07         
012-074-E10         
012-076-E11         
014-006-C07         
014-085-G11         
015-049-C04         
015-062-E10         
016-063-E02         
AK058349            
AK105922            
AK106163            
AK119553            
AY831395            
TSS from cDNA
TSS information
006-093-E07                      5'->3' (-)
Promoter sequence










 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of 006-093-E07

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS clone peakAclone-4351794-61

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCTCTCTCCTTCCTC-43517954351808-62-75
Y PatchCCCCCCTCCCCC-43518304351841-97-108
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCCCCGCGTGGGCCCCACCCACCTG-43519334351957-200-224
 OsREG537CCCCCGCG                  PPDB Motif  PLACE Motif 
 OsREG530    CGCGTGGG              PPDB MotifGCCCA  PLACE Motif 
 OsREG602     GCGTGGGC             PPDB MotifGCCCA  PLACE Motif 
 OsREG571      CGTGGGCC            PPDB MotifGCCCA  PLACE Motif 
 OsREG640       GTGGGCCC           PPDB MotifGCCCA  PLACE Motif 
 OsREG647        TGGGCCCC          PPDB MotifGCCCA  PLACE Motif 
 OsREG641         GGGCCCCA         PPDB MotifGCCCA  PLACE Motif 
 OsREG631          GGCCCCAC        PPDB Motif  PLACE Motif 
 OsREG612           GCCCCACC       PPDB Motif  PLACE Motif 
 OsREG514                 CCCACCTG PPDB MotifGCCCA  PLACE Motif 
REGCAAGTGGG-43520004352007-267-274
 OsREG498CAAGTGGG PPDB MotifGCCCA  PLACE Motif 
REGCACGGCCCG-43520284352036-295-303
 OsREG504CACGGCCC  PPDB MotifGCCCA  PLACE Motif 
 OsREG446 ACGGCCCG PPDB MotifACGGGC  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.