version
PlantPromoterDB promoter information of 006-097-B03

Summary of Gene (006-097-B03)

Organism Oryza sativa  
Chromosome 7  
Locus Os07g0577600        NCBI 
Gene model 006-097-B03  
Description NONE  
#
#

Overview

Focused view (chromosome 7: 24016694-24017893)

Genome position     
from initiation codon
006-080-H04         
006-093-B08         
006-096-A06         
J075083G03          
J075094I22          
TSS from cDNA
TSS information
006-097-B03                      5'->3' (+)
Promoter sequence




 
                    
TSS from cDNA
TSS information
                                 3'->5' (-)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of 006-097-B03

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneCclone+24017935-159
TSS clone peakCclone+24017946-148
TSS cloneGclone+24017949-145
TSS cloneAclone+24017950-144
TSS cloneAclone+24017953-141
TSS cloneCclone+24017955-139
TSS cloneAclone+24017956-138

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCTCGCCC+2401774124017748-353-346
 OsREG549CCTCGCCC PPDB MotifGCCCA  PLACE Motif 
REGCGGGCCCCACC+2401775924017769-335-325
 OsREG567CGGGCCCC    PPDB MotifACGGGC  PLACE Motif 
 OsREG641 GGGCCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG631  GGCCCCAC  PPDB Motif  PLACE Motif 
 OsREG612   GCCCCACC PPDB Motif  PLACE Motif 
REGCGCCACGTC+2401778524017793-309-301
 OsREG448CGCCACGT  PPDB MotifACGT  PLACE MotifACGTGKC 
 OsREG585 GCCACGTC PPDB MotifACGT  PLACE MotifACGTGKC 
REGCGCGACGCG+2401783824017846-256-248
 OsREG556CGCGACGC  PPDB Motif  PLACE MotifCGACG 
 OsREG559 GCGACGCG PPDB Motif  PLACE MotifCGACG 
REGGCCCATCC+2401787824017885-216-209
 OsREG608GCCCATCC PPDB MotifGCCCA  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.