version
PlantPromoterDB promoter information of 006-098-C05

Summary of Gene (006-098-C05)

Organism Oryza sativa  
Chromosome 7  
Locus Os07g0558400        NCBI 
Gene model 006-098-C05  
Description NONE  
#
#

Overview

Focused view (chromosome 7: 22979033-22977834)

Genome position     
from initiation codon
003-103-C02         
003-115-G05         
006-025-B09         
006-025-G10         
006-027-E03         
006-036-C06         
006-045-B10         
006-051-H11         
006-053-H03         
006-057-B09         
006-062-C10         
006-075-B12         
006-079-F01         
006-082-D08         
006-087-F04         
006-089-E09         
006-090-C04         
006-091-H05         
006-093-E02         
006-093-E06         
006-093-H05         
006-095-C05         
006-097-B04         
006-097-C07         
006-097-D02         
006-097-H10         
006-099-H09         
006-104-B06         
006-105-B11         
006-106-E12         
006-107-B06         
006-109-A09         
006-112-D05         
006-118-C12         
006-118-E10         
006-120-D05         
006-120-E08         
009-055-D12         
009-108-E05         
009-125-H05         
009-150-A07         
009-198-C07         
AF058796            
AK058293            
AK098992            
AK103924            
AK104309            
AK104619            
AK119534            
J013098H13          
J043039O11          
J065176D03          
J075022K10          
J075065A02          
J075077D23          
J075088P15          
J075125D24          
J075125H11          
J075192H21          
J090080H18          
TSS from cDNA
TSS information
006-098-C05                      5'->3' (-)
Promoter sequence







 
                    
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence

 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of 006-098-C05

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneAclone-22978079-46
TSS clone peakAclone-22978076-43
TSS cloneAclone-22978072-39

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCCCCCTC-2297808322978090-50-57
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGCCGTCCGATC-2297815522978164-122-131
 OsREG545CCGTCCGA   PPDB Motif  PLACE Motif 
 OsREG484 CGTCCGAT  PPDB Motif  PLACE Motif 
 OsREG589  GTCCGATC PPDB Motif  PLACE Motif 
REGGGCCCGGA-2297821522978222-182-189
 OsREG633GGCCCGGA PPDB Motif  PLACE Motif 
REGCCCATCCA-2297824022978247-207-214
 OsREG534CCCATCCA PPDB MotifGCCCA  PLACE Motif 
REGCCACGTGTC-2297826922978277-236-244
 OsREG434CCACGTGT  PPDB MotifACGT  PLACE Motif 
 OsREG509 CACGTGTC PPDB MotifACGT  PLACE MotifACGTGKC 
REGCCCAGCCC-2297827922978286-246-253
 OsREG533CCCAGCCC PPDB MotifGCCCA  PLACE Motif 
REGTGGGGCCCATCCACC-2297833422978348-301-315
 OsREG641TGGGGCCC        PPDB MotifGCCCA  PLACE Motif 
 OsREG647 GGGGCCCA       PPDB MotifGCCCA  PLACE Motif 
 OsREG489  GGGCCCAT      PPDB MotifGCCCA  PLACE Motif 
 OsREG590   GGCCCATC     PPDB MotifGCCCA  PLACE Motif 
 OsREG608    GCCCATCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG534     CCCATCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG515       CATCCACC PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGNoneNoneNone


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.