version
PlantPromoterDB promoter information of 006-098-D12

Summary of Gene (006-098-D12)

Organism Oryza sativa  
Chromosome 1  
Locus Os01g0706000        NCBI 
Gene model 006-098-D12  
Description NONE  
#
#

Overview

Focused view (chromosome 1: 31041296-31040097)

Genome position     
from initiation codon
                    
TSS from cDNA
TSS information
006-098-D12                      5'->3' (-)
Promoter sequence

 
AK072799            
J013049G14          
J023136E17          
TSS from cDNA
TSS information
                                 3'->5' (+)
Promoter sequence




 
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Promoter Summary of 006-098-D12

TSS information

TypeSequenceTPM scoreGenome positionPosition from initiation codon
   StrandPositionPosition
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionPosition from initiation codon
   StrandPositionPosition
TSS cloneGclone-31038743-97
TSS clone peakAclone-31038718-72
TSS cloneGclone-31038664-18

Core promoter information

TypeSequenceGenome positionPosition from initiation codon
  StrandStartEndStartEnd
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchNoneNoneNone
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionPosition from initiation codon
   StrandStartEndStartEnd
REGGGGCCGGA-3103879331038800-147-154
 OsREG644GGGCCGGA PPDB MotifGCCCA  PLACE Motif 
REGTGAGGGAC-3103883631038843-190-197
 OsREG652TGAGGGAC PPDB MotifGGGACCC  PLACE Motif 
REGTGTGGGCCCCACA-3103896531038977-319-331
 OsREG627TGTGGGCC      PPDB MotifGCCCA  PLACE Motif 
 OsREG640 GTGGGCCC     PPDB MotifGCCCA  PLACE Motif 
 OsREG647  TGGGCCCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG641   GGGCCCCA   PPDB MotifGCCCA  PLACE Motif 
 OsREG631    GGCCCCAC  PPDB Motif  PLACE Motif 
 OsREG611     GCCCCACA PPDB Motif  PLACE Motif 

Other Reliable Promoter Summary

TSS information

TypeSequenceTPM scoreGenome positionGene model
   StrandPosition 
Not Available Not Available Not Available Not Available Not Available 

TSS information from cDNA

TypeSequenceScoreGenome positionGene model
   StrandPosition 
TSS clone peakAclone+31041259AK072799, J013049G14, J023136E17, AK072799

Core promoter information

TypeSequenceGenome positionGene model
  StrandStartEnd 
initiatorNot AvailableNot AvailableNot Available
TATA BoxNoneNoneNone
Y PatchCCCCCCTC+3104124431041251AK072799, J013049G14, J023136E17
Y PatchCCCCTCCCCT+3104129231041301AK072799, J013049G14, J023136E17
GANoneNoneNone
InrNoneNoneNone

REG information

TypeSequenceAnnotationGenome positionGene model
   StrandStartEnd 
REGTGAGGGAC+3104108531041092AK072799, J013049G14, J023136E17
 OsREG652TGAGGGAC PPDB MotifGGGACCC  PLACE Motif 
REGCTTGGGCCGGT+3104113731041147AK072799, J013049G14, J023136E17
 OsREG581CTTGGGCC    PPDB MotifGCCCA  PLACE Motif 
 OsREG563 TTGGGCCG   PPDB MotifGCCCA  PLACE Motif 
 OsREG542  TGGGCCGG  PPDB MotifGCCCA  PLACE Motif 
 OsREG440   GGGCCGGT PPDB MotifGCCCA, AACCG(G/A)  PLACE Motif 
REGTCATGGGCT+3104115631041164AK072799, J013049G14, J023136E17
 OsREG609TCATGGGC  PPDB MotifGCCCA  PLACE Motif 
 OsREG467 CATGGGCT PPDB MotifGCCCA, CCATGG  PLACE Motif 


Copyright(c) 2007- ppdb Stirring Committee. All Rights Reserved.